... antigen induced AHR in wild-type, Mcp-1-/- and Ccr2-/- mice Aspergillus Aspergillus antigen induced AHR in wild-type, Mcp-1-/and Ccr2-/- miceAirway reactivity in response to intravenous acetylcholine ... and maintained under specific pathogen-free conditions in the Laboratory Animal Resource Center at San Francisco General Hospital All mice were backcrossed nine times with C5 7BL/ 6mice (Jackson ... reactivity in many model systems, the mice used here were produced by extensive backcrossing into a C5 7BL/ 6 genetic background Both MCP-1- and CCR2-deficient mice developed marked airway inflammation...
... 2,3-Bis(3-hydroxymyristoyl)b-D-glucosamine-1-phosphate Acyl carrier protein b-Hydroxy-cis-D5-decenoyl-ACP b-Keto-cis-D5-decenoyl-ACP Cis-D3-decenoyl-ACP Cis-D5-decenoyl-ACP D-3-Hydroxy-acyl-ACP Dihydroxyacetone ... consistent with the EcoCyc database Abbreviation Name 2,3-b(3hm) bD-GA-1P ACP bhcd5dACP bkcd5d-ACP cd3dACP cd5dACP D-3-ho-acyl-ACP DHAP G3P KDO L1-P-EtAmine lipid A-disacch td2enoyl-acyl-ACP td3cd5dACP ... the cycles into two parts each We did not include in the system the protein encoded by the gene ybhO, which is homologous to Cls [ 56] YbhO lacks a part of the sequence of Cls, and was found to...
... detected within the nuclear compartment Conversely, there was a strong accumulation of cytoplasmic versus nuclear vector DNA in the case of DNA Flap- vector with an average nuclear/cytoplasmic ... strong accumulation of nuclear versus cytoplasmic vector DNA in the case of DNA Flap+ vector with an average nuclear/cytoplasmic ratio of 3.9 ± 0.9, which means that 77.3 ± 3 .6% of total vector DNA ... Quantification of intracellular vector genome detection Quantification of intracellular vector genome detection (A) Electron micrograph of control non-transduced cells showing minimal background...
... declaration sheet incase there is no error 36 Print out the receiver number and bring it to the Customs Office to customs procedures with a click on button in on the window of inputing declaration ... account connecting to the Customs ( Contact the Custom’s IT staffs to receive connecting account) This function allows you change the passwords used for connecting to the Customs system Input old passwords ... declaration sheet to the Customs Office You must have the user name and passwords used for connecting to the Custom system (Contact with the Customs office where you customs procedures to receive...
... PCR using the following gene-speci c primer sets: 5¢-TCCCATCTGTAGCAGCA ACT-3¢ and 5¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGG GCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ ... analysed five human carcinoma cell lines: a lung carcinoma cell line A549, a colon carcinoma cell line LoVo, stomach carcinoma cell lines MKN45 and MKN74, and HepG2 Protease TMPRSS13 is inhibited by ... enzyme in mammalian cells To obtain an active TMPRSS13 in mammalian cells, we constructed an expression vector encoding a recombinant protein with two modifications, and transfected COS-7 cells with...
... VP 16- PC7 and VP 16- furin were generated by fusing VP 16 to ICDs of mouse PC5/6B (amino acids 1 461 –1548), human PC7 (amino acids 68 4– 785) or furin (amino acids 738–794) To create EGFP-furin ICD, ... therefore could be involved in the intracellular traf c of MT1-MMP AAA573 to the cell surface It would be interesting to assess the role of GRASP65 with respect to MT1MMP trafficking to the cell surface ... phototoxicity and bleaching Coverslips (PeCon GmbH, Erbach, Germany) were placed in a POC-R imaging chamber (PeCon GmbH) containing phenol-red free Hepes-buffered medium and kept at 37 C using...
... 5¢-CAGCCGCCGTAGAAGTT GTAAGTCATCGCAAAG-3¢, 5¢-CGCCGCCACCAGGG AACATCCAGTCAATATCTAC-3, and 5¢-GCCGCCAC CAGGGAATTGCCAGTCAATATCTAC-3¢, respectively Confirmation of the mutated nucleotides by automated ... (sequences underlined) were 5¢-CTTTGCGATGACTTAC AACTTCTACGGCGG-3¢, 5¢-GTAGATATTGACTGGAT GTTCCCTGGTGGCGGCG-3¢ and 5¢-GATATTGACTG GCAATTCCCTGGTGGCGGC-3¢, and the reverse oligonucleotide sequences ... This corresponds to three different isomers (e.g GlcNAc.GlcNAc.GlcN, GlcNAc.GlcN GlcNAc, and GlcN.GlcNAc.GlcNAc), in accordance with the location of three acetyl moieties The signal -to- noise ratio...
... lower overall catalytic efciency with this coenzyme The single proline to serine mutation at position 262 likewise decreased the overall catalytic efciency with both oxidized coenzymes Using NAD+, ... R, Clarke AR & Holbrook JJ (1990) A single amino acid substitution in lactate dehydrogenase improves the catalytic efciency with an alternative coenzyme Biochem Biophys Res Commun 166 , 66 767 2 ... reaction monitored in the main panel (B) Correction applied to the burst amplitudes calculated at different enzyme concentrations in (A) The increase of enzyme concentration causes a signicant...
... a (C6 ¢-N1¢ -C2 ¢ -C3 ¢), b(N1¢ -C2 ¢ -C3 ¢-N4¢), c( C2¢ -C3 ¢N4¢ -C5 ¢), d (C3 ¢-N4¢ -C5 ¢ -C6 ¢), e(N4¢ -C5 ¢ -C6 ¢-N1¢), n (C5 ¢ -C6 ¢-N1¢ -C2 ¢), v1 (C8 ¢ -C7 ¢-N4¢ -C3 ¢), v2(N9 ⁄ N1 -C8 ¢ -C7 ¢-N4¢) and v3 (C4 ⁄ C2 -N9 ⁄ N1 -C8 ¢ -C7 ¢) ... by six backbone torsion angles, a (C6 ¢-N1¢ -C2 ¢ -C3 ¢), b(N1¢ -C2 ¢ -C3 ¢-N4¢), c( C2¢ -C3 ¢N4¢ -C5 ¢), d (C3 ¢-N4¢ -C5 ¢ -C6 ¢), e(N4¢ -C5 ¢ -C6 ¢-N1¢) and f (C5 ¢ -C6 ¢-N1¢ -C2 ¢) These are found to be confined to the trans ... mutation, occurring in codon 12 of the Ki-ras proto-oncogene, replaces GGT with GAT [32] (capped region in Scheme 1) in one of the alleles of pancreatic cells This leads to pancreatic cancer [32],...
... 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ ... GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined) Constructs containing a His- or Strep-tag in ... 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C- terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢...
... broth (with a GO speci c activity in the crude extract of 0.0 06 UÆmg)1 protein) GO accumulated to 1% of total E coli soluble proteins in the crude extract Recombinant GO was purified from E coli cells ... Fast-Flow column (1 .6 · 21 cm) and eluted with a 10–20% linear gradient using buffer A to which M NaCl was added Fractions containing GO activity were pooled and concentrated using an Amicon cell concentrator ... (5¢-CCGAT GAATTCCATCATATCTGAACCGCCTCCTTGCG-3¢) derived from the 3¢ end of nucleotide sequence of yjbR gene (the sequence recognized by EcoRI restriction enzyme is underlined) This amplification...
... discussed in previous papers [ 16, 19], each part reflects first the binding of RXP407 to the N-domain at low inhibitor concentration, followed at higher concentrations by inhibitor binding to the C- domain ... N-domain and C- domain in cleaving the Mca-Ala substrate, in the presence of RXP compounds, are in good agreement with the catalytic efficiency determined for the enzyme without inhibitor Specifically, ... Specifically, for each ACE species, the catalytic efficiency of the free enzyme corresponds to the sum of the catalytic efficiencies determined for the N-domain and C- domain in the presence of inhibitor These...
... GTGGAAGGC-3¢; Eco91I-inv, 5¢-CTCATCCAGATCG GTTACCCAATC-3¢; H334G-for, 5¢-TACACCAACGGAA 5112 CCGTGCTCAC-3¢; H334G-inv, 5¢-GTGAGCACGGTTC CGTTGGTGTACGC-3¢ The plasmid pQE70–CcStP [42] containing the ... NMR spectroscopy techniques for screening and identifying ligand binding to protein receptors Angew Chem Int Ed 42, 864 –890 Johnson MA & Pinto BM (2004) NMR spectroscopic and molecular modeling ... Therefore, CcStP appears to differ subtly from maltodextrin and glycogen phosphorylase in how it copes with constraining the cofactor phosphate group into a configuration that is believed to promote catalysis...
... assays conducted using Gln-OH, a freshly prepared stock solution was stored on ice and added cold to each assay This protocol was necessary to minimize cyclization of Gln-OH with concomitant production ... conformational change because of differences between the packing of the leucine vs alanine side chains with GTP leading to a more signicant ễkinkế Although the kink/constriction could occur at any point ... hydroxylamine present in the solution for incorporation into UTP as catalysed by Lactococcus lactis CTP synthase Arch Biochem Biophys 424, 105111 Weng, M., Makaro, C. A & Zalkin, H (19 86) Nucleotide...
... by using Origin 6. 0 graphics and data analyses software The culmination point of each curve was taken as the melting temperature All points were measured at least in duplicate According to theoretical ... pH optimum, such as Humicola insolens Cel7B endoglucanase, has an in uence on the activity of the enzyme at more alkaline pH by interacting with the catalytic acid/base D217 Introduction of these ... Tm spectra with a distinct minimum around 202 nm, which is typical for an unfolded protein consisting mainly of random coil structure [20], were found with both proteins The CD unfolding curves...
... MDBK cells (ATCC CCL-22) Each cell line was infected at a multiplicity of infection (m.o.i.) of and cultured for 72 h Then, infected cells were lysed by three freeze/thaw cycles One fifth of each ... in non-avian species Vaccine 1988, 6: 466 -8 Taylor J, Weinberg R, Languet B, Desmettre P, Paoletti E: Recombinant fowlpox virus inducing protective immunity in nonavian species Vaccine 1988, 6: 497-503 ... 2000, 74(3):1114-23 McCabe VJ, Tarpey I, Spibey N: Vaccination of cats with an attenuated myxoma virus expressing feline calicivirus capsid protein Vaccine 2002, 20:2454-2 462 McCabe VJ, Spibey N:...
... MDBK cells (ATCC CCL-22) Each cell line was infected at a multiplicity of infection (m.o.i.) of and cultured for 72 h Then, infected cells were lysed by three freeze/thaw cycles One fifth of each ... in non-avian species Vaccine 1988, 6: 466 -8 Taylor J, Weinberg R, Languet B, Desmettre P, Paoletti E: Recombinant fowlpox virus inducing protective immunity in nonavian species Vaccine 1988, 6: 497-503 ... 2000, 74(3):1114-23 McCabe VJ, Tarpey I, Spibey N: Vaccination of cats with an attenuated myxoma virus expressing feline calicivirus capsid protein Vaccine 2002, 20:2454-2 462 McCabe VJ, Spibey N:...
... TAC AAT GTG CTT CCA CAG GG 184W: TCC TAC ATA CAA ATC ATC CAT 184G: CCT ACA TAC AAA TCA TCC AC 184I: GAT CCT ACA TAC AAA TCA TCT Pr-2W: CT GAA ATC TAC TAA TTT TCT CCA CT Pr-2M: CT GAA ATC TAC ... (Invitek; Berlin, Germany) according to the manufacturer's instructions The purified PCR products were sequenced with the forward primer Pol F1 (5'GCC TGA AAA TCC ATA TAA CAC TCC-3') on an automated ... and children were recruited The patients' mean CD4+ cell count was 2 76. 7 ± 238.1 cells/mcL, while their mean CD8+ cell count was 999.1 ± 598.4 cells/mcL POL Pr-2: TCA TTG ACA GTC CAG CTA TCC TTT...