biển nào cấm mọi loại xe cơ giới đi vào trừ xe gắn máy môtô 2 bánh và các loại xe ưu tiên theo luật định 1 biển 1 2 ca ba biển 3 biển 2 4 biển 1 và 3
Experimental study of RO membrane organic fouling for wastewater reclamation
... 30 2. 3 .2. 2 Scaling 34 2. 3 .2. 3 Biofouling 35 2. 3 .2. 4 Organic fouling 39 2. 3. 3 Fouling potential assessment and foulant characterization 39 2. 4 Organic ... 11 9 4 .2. 1 Distribution, composition and characteristics of EfOM fractions 12 0 4 .2. 2 Membrane fouling by various EfOM fractions 12 5 4 .2. 2 .1 Flux decline rate and extent 12 5 4 .2. 1 .2 ... surface morphology 11 3 4 .1. 3. 4 Changes in membrane surface chemistry 11 5 4 .1. 4 Fouling Potential with Increasing Recovery 11 6 4 .1. 5 Summary – Part 11 8 4 .2 Part – Fouling of...
- 173
- 1,289
- 1
Rejection of steriod hormone estrone by NF RO membranes
... Hormone Formula E1 E2 EE2 C18H22O2 C18H24O2 C20H24O2 Molecular weight (g/mol) 27 0 .4 27 2 .4 29 6 .4 Water solubility at 20 ºC (mg/L) 13 .0 13 .0 4. 8 pKa logKow 10 .4 10 .4 10 .2 3. 4 3. 9 4 .2 10 Chapter Two ...
- 220
- 172
- 0
A STUDY ON ENGLISH WORDS FORMED BY CONVERSION RELATING TO THE NAMES OF ANIMALS
... Chapter one: THEOTICAL BACKGROUND I .1 What is conversion I .2 Characteristic of features I .2. 1 Morphologically I .2. 2 Syntactically I .3 Common conversions I .3 .1 Phenomena of conversion I .3 .2 Common ... dictionary; 20 07 : 34 4) (11 ) Because he is very chicken, he does not climb the tree (adjective) (English- Vietnamese dictionary; 20 07 : 34 4) The verb “chicken” in (10 ) and the adjective “chicken” in (11 ) ... converted into a new verb “to signal” In this case, there is no blocking because these words have slight semantic different (Bauer, 19 83 :22 6 -22 7) I .2. 2 Syntactically The new word has new part of speech...
- 71
- 751
- 1
Some suggestions for correcting errors made by english non major first year students at HPU of pronouncing ending sounds
... 1 .2% 2. 4% 6.6% 3. 9% 6.6% 3. 6% 6 .1% 3 .1% 7.5% 7.8% 6 .1% 2. 9% /ʒ/ 20 28 6.8% /tʃ/ 22 30 7 .3% /dʒ / /t/ /m/ /n/ /ʃ/ / ŋ/ /l/ Total Percentage 0 0 0 24 6% 0 19 13 90 22 % 22 27 6 29 5 72% 29 29 6 23 13 ... 23 Types of errors Insertion Substitution Omission Total Percentage /b/ /t/ /d/ /k/ /g/ /f/ /v/ /θ/ /ð/ /s/ /z/ 5 5 0 0 0 2 7 0 20 14 20 10 15 25 25 25 12 10 27 16 27 15 25 13 31 32 25 12 1 .2% ... Percentage /p/ 23 % /k/ 21 % /b/ 26 % /g/ 15 % /t/ 30 % /f/ 26 % /d/ 19 % /v/ 21 % /θ/ 75% /ʒ/ 53% /ð/ 81% /tʃ/ 72% /s/ 13 % /dʒ / 76% /z/ 11 % /ŋ/ 26 % /m/ 16 % /ʃ/ 73% /n/ 14 % /l/ 52% Table 1: The percentage...
- 71
- 897
- 1
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... (0.0 04) Bottom 0 .17 7 0 .22 3 0 .17 3 0 .20 7 0 . 23 1 0 .16 7 0 . 24 0 0 .17 6 0 .20 4 0 . 24 0 0 .18 5 0 .20 1 0 .18 8 0 . 21 3 0 .22 9 0 .17 8 0 . 21 0 0 .15 7 0 .18 7 0 . 21 7 0 .26 0 0 . 23 1 0 . 23 8 0 .26 3 0 . 21 3 0 .28 0 0 . 21 3 0 .19 6 0 . 24 5 0 .18 5 ... (0. 010 ) (0.0 12 ) 0 .16 6 0 . 21 7 0 .17 7 0 .20 2 (0.007) (0.005) (0. 0 13 ) (0.009) 30 64 Tier 0 .22 3 0 .27 4 0 . 21 9 0 .25 0 0 . 24 3 0 . 21 3 0 . 24 9 0 .22 0 0 . 24 0 0 .28 4 0 . 21 6 0 . 23 2 0 . 21 7 0 . 24 2 0 .25 2 0 . 21 8 0 .25 2 0 .20 0 0 .22 8 Bottom ... molecules ratio A1 A2 A3 A4 B1 B2 B3 B4 C1 C2 a 0a 10 0 10 0 0 0 10 0 )3 12 2 32 3 12 2 30 0 32 3 30 0 32 3 32 3 )2 +1 +7 )3 12 0 69 12 68 73 6 922 6878 6 949 6 948 69 51 6 948 6 928 6888 56.6 56 .3 56.7 56 .4 57.0 57.0...
- 16
- 475
- 0
A study on difficulties in learning speaking skill faced by non-English major students at Hanoi University of Industry = Nghiên cứu về những khó khăn trong việc
... teachers’ talking time 13 .3 18 3. 42 - Inappropriate teachers’ 26 .6 92 17 .49 26 .6 0 - Teachers’ unfriendliness 13 .3 12 2 .28 - Teachers’ inadequate 20 12 2 .28 6.7 68 12 . 93 11 73. 3 39 3 74. 71 b Students’ ... pronunciation, stress and teachers 14 93. 3 42 4 80. 61 33 .3 59 11 . 21 10 66.6 4 62 87. 83 b Multilevel classes 14 93. 3 4 63 88. 02 c Uninteresting textbooks 13 .3 13 2. 47 correction - Inappropriate teachers’ ... teachers at HaUI 23 2. 2 The study 24 2. 2 .1 Participants 24 2. 2 .2 Sampling 25 2. 2 .3 Research methodology 25 2. 2 .4 Data collection methods 25 2. 2.5 Procedures 25 2. 3 Data analysis 27 PART C: 41 CONCLUSION...
- 77
- 5,677
- 32
Colloquial language used in speaking classes by the English major sudents of Foreign Language Faculty - Thai Nguyen University= Ngôn ngữ thông tục được sử dụng
... Frequency Often Sometimes Seldom 0% 0% 33 .6% 66 .4% 0% 0% 16 .4% 77 .4% 6 .2% 0% 0% 25 .3% 74. 7% 8 .2% 69.9% 21 .9% 0% 0% 23 .3% 66 .4% 10 .3% 0% 2. 1% 25 .3% 46 .6% 22 .6% 3. 4% Almost Phonetics Never always Reduced ... School Experience of learning English M F G S 10 years 14 6 39 10 7 12 3 23 37 10 5 10 0% 26 .7% 73. 3% 84 .2% 15 .8% 2. 7% 25 .4% 71. 9% M: male; F: female; G: General high school; S: Specialized ... Morphological features 10 1 .2. 3. 3 Syntactical features 10 1 .2. 3. 4 Lexical features 11 1 .2. 4 Significance of colloquial English speech 14 1. 3 Colloquial English speech...
- 59
- 608
- 1
TEACHERS CORRECTIVE FEEDBACK ON THE PRONUNCIATION OF ENGLISH FRICATIVES AND AFFRICATES BY NON-ENGLISH MAJOR FRESHMEN
... I.8 .1 Definition of Teacher’s Corrective Feedback I.8 .2 Types of Teacher’s Corrective Feedback I.9 Teacher’s Explicit Corrective Feedback I .10 Theoretical and Empirical Background on TECF I .11 ... research hypothesis stated in Section III .1 First, based on a pre-test of the six consonants / s, z, ʃ, ʒ, ʤ, ʧ/ administered to 36 students in the class KT40B, 34 participants were selected and assigned ... They are case scoring 79 points and case 30 scoring 61 points Hence, for the purpose of the study, the two students were ruled out from the sample The main subjects of the study are 34 students...
- 18
- 655
- 0
TEACHERS CORRECTIVE FEEDBACK ON THE PRONUNCIATION OF ENGLISH FRICATIVES AND AFFRICATES BY NON-ENGLISH MAJOR FRESHMEN
... Case Case 11 67 68 Case 29 Case 19 Pair Pair Pair Pair Pair Pair Pair 10 68 Case 17 68.5 Case 25 69 Case 13 70 Case 36 70.5 Case 28 71 Case 26 73 Case 27 74 68 Case 12 68.5 Case 22 69 Case 33 ... 68.5 Case 22 69 Case 33 70 Case 32 70.5 Case 34 71 Case 73 Case 74 68.5 Case 31 69.5 Case 24 71 Case 21 72. 5 Case 35 75 69.5 Case 23 70 Case 71. 5 Case 14 72 Case 15 74 • Coins were flipped for ... Corrective Feedback 21 I .10 Theoretical and Empirical Background on TECF 23 I .10 .1 Theoretical Background on TECF 23 I .10 .2 Empirical Background on TECF 25 I .11 Research Gap...
- 91
- 651
- 0
SUMMARY OF THESIS TEACHERS CORRECTIVE FEEDBACK ON THE PRONUNCIATION OF ENGLISH FRICATIVES AND AFFRICATES BY NON-ENGLISH MAJOR FRESHMEN
... I.8 .1 Definition of Teacher’s Corrective Feedback I.8 .2 Types of Teacher’s Corrective Feedback I.9 Teacher’s Explicit Corrective Feedback I .10 Theoretical and Empirical Background on TECF I .11 ... research hypothesis stated in Section III .1 First, based on a pre-test of the six consonants / s, z, ʃ, ʒ, ʤ, ʧ/ administered to 36 students in the class KT40B, 34 participants were selected and assigned ... They are case scoring 79 points and case 30 scoring 61 points Hence, for the purpose of the study, the two students were ruled out from the sample The main subjects of the study are 34 students...
- 18
- 597
- 0
A study on common errors related to the usage of DO and MAKE collocations by English non-major students at Thai Nguyen University of Economics and Business Administration (TUEBA)
... Eldaw, M (19 93) , “Should we teach EFL students collocations?” System, 21 (1) , pp 10 1 -11 4 Cambridge Advanced Learners’ Dictionary (20 05), CUP, Cambridge Channell, J (19 81) , “Applying semantic theory ... Cambridge Nesselhauf, N (20 03) , “The use of collocations by advanced learners of English and some implications for teaching”, Applied Linguistics, 24 (2) , pp 22 3 - 24 2 Palmer, H E (19 33 ), Second Interim ... approaches, CA: Sage Publications, Inc Martynska, M (20 04) , “Do English language learners know collocations?” Investigation Linguistics, 11 (1) , pp 1- 12 Matsuno and Sugiura (20 02) , The Acquisition of Basic...
- 3
- 817
- 7
the types of feedback used by teachers of english at vietnam university of commerce and their effectiveness on improving oral presentation skills of the second year – english major students
... mistakes yourself Total 38 .1 29 .2 23. 7 28 .6 16 .7 2. 4 19 21 .4 28 .6 21 .4 14 .3 38 31 16.7 11 .9 42 . 8 40 .5 2. 4 27 .4 32 . 7 39 .9 19 26 .2 40 .5 14 .3 14 .3 23 .8 38 .1 16.7 20 .2 25 54. 8 Frequency of teachers’ ... Never % Seldom % Sometimes Often % % Always % 2. 4 7 .1 40 .5 33 .3 16 .7 2. 4 14 .3 47 .6 19 16 .7 14 .3 26 .6 35 .7 19 4. 8 23 .8 40 .5 28 .6 7 .1 Corrective feedback Your teacher helps you notice and correct ... intonation 9.5 66.7 23 .8 26 .2 40 .5 33 .3 35.7 59.5 4. 8 38 .1 40 .5 21 .4 27 .4 Total Evaluative feedback Your teacher criticizes you when you 52. 4 make mistakes Your teacher gives comments/ 21 .4 explanation...
- 48
- 601
- 2
Tài liệu Báo cáo khoa học: Upregulation of DR5 by proteasome inhibitors potently sensitizes glioma cells to TRAIL-induced apoptosis doc
... 27 5 (20 08) 1 925 19 36 ª 20 08 The Authors Journal compilation ª 20 08 FEBS H Hetschko et al 14 15 16 17 18 19 20 21 22 23 24 25 Bax-dependent mitochondrial cell death pathway Oncogene 24 , 40 52 40 64 ... Reifenberger G, Burger PC & Cavenee WK (20 02) The WHO classification of tumors of the nervous system 19 34 13 J Neuropathol Exp Neurol 61, 21 5 22 5; discussion 22 6 21 9 Maher EA, Furnari FB, Bachoo RM, Rowitch ... siRNAs from Dharmacon (Chicago, IL, USA) were used: CHOP siGenome duplexes D-0 04 819 - 01- 0005 and D-0 04 819 - 02- 0005; and DR5 siGenome duplexes D-0 044 48- 01- 0005 and D-0 044 48- 03- 0005 Scrambled siRNA...
- 12
- 440
- 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... (p 53/ 55) p18 Band intensity (arbitrary units) p 41 / 43 10 0 p 41 / p 43 p18 HeLa cells ( 14 3% ) 75 50 (88%) (90%) (10 3% ) 25 p 53/ p55 p 41 / p 43 p18 Fig Effects of IFNa and TRAIL on levels and activation of caspase-8 ... (4h) 18 0 36 0 540 720 18 0 36 0 540 720 +TRAIL (4h) Sub-G1 1. 6% 0 20 0 40 0 600 20 0 DNA content 600 Ce ll c ount Sub-G1 6 .1% + IFNα +TRAIL (16 h) 18 0 36 0 540 720 +TRAIL (16 h) 18 0 36 0 540 720 40 0 DNA content ... Sub-G1 0 .3% + IFNα 18 0 36 0 540 720 18 0 36 0 540 720 Control Sub-G1 0 .4% 0 Cell count Control of protein synthesis by IFNa and TRAIL 20 0 40 0 20 0 600 C ell count Sub-G1 0.8% + IFNα +TRAIL (4h) 18 0 36 0...
- 11
- 679
- 0
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx
... the 41 - / 43 - kDa mitogen-activated protein kinase signalling pathway in human tumors Oncogene 18 , 8 13 – 822 21 Bos, J.L (19 89) ras oncogenes in human cancer: a review Cancer Res 49 , 46 82 46 89 22 Kholodenko, ... Biol Chem 26 0, 14 538 – 14 546 32 Lee, L.S & Weinstein, I.B (19 78) Tumor-promoting phorbol esters inhibit binding of epidermal growth factor to cellular receptors Science 20 2, 31 3 – 31 5 33 Bao, J., ... Nature 36 4, 24 9 25 2 Ó FEBS 20 04 25 Carroll, M.P & May, W.S (19 94) Protein kinase C-mediated serine phosphorylation directly activates Raf- in murine hematopoietic cells J Biol Chem 26 9, 12 4 9– 12 5 6 26 ...
- 9
- 541
- 0
Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx
... al 16 17 18 19 20 21 22 23 24 25 26 receptor peroxisome proliferator-activated receptor-delta accelerates intestinal adenoma growth Nat Med 10 , 24 5 24 7 Hao CM, Redha R, Morrow J & Breyer MD (20 02) ... 27 6, 42 7 37 – 42 7 43 30 Michalik L, Desvergne B & Wahli W (20 04) Peroxisome-proliferator-activated receptors and cancers: complex stories Nat Rev Cancer 4, 61 70 31 Bishop-Bailey D & Wray J (20 03) ... control Gene Ther 6, 12 7 6– 12 8 1 38 Gehrke S, Jerome V & Muller R (20 03) Chimeric transcriptional control units for improved liver-specific transgene expression Gene 32 2 , 13 7 14 3 39 Schweer H, Watzer...
- 10
- 434
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... data of k1, k2 and k over the range of the ratio [Yb3+]/protein between and are linearly fitted: k1 ¼ 1 .26 8x + 2. 44 9, R2 ¼ 0.979; k2 ¼ 0.704x + 0 .11 0, R2 ¼ 0.9 52; k ¼ 1 . 21 6x + 0.508, R2 ¼ 0.996 ... K1 ½Yb3þ free þ K1 K2 ½Yb3þ 2 free 1 ½Yb3þ where ¼ ½Tf bind , K1 (¼ 1/ Kd1) and K2 (¼ 1/ Kd2) are n total the stepwise association constants 3+ At low [Yb ]total, all of the added Yb3+ ... the basis of e280 93 000, 10 3 000 and 11 3 000 M )1 cm )1 for apo-Tf, FeC-Tf and Fe2-Tf, respectively [ 23 ] The iron saturation of FeC-Tf and Fe2-Tf was also estimated from the ratio of A280nm/A465nm...
- 9
- 385
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... digestion J Biol Chem 26 7, 21 7 61 21 7 64 10 Oguiza JA, Marcos AT, Malumbres M & Martı´ n JF (19 96) The galE gene encoding the UDP-galactose 13 15 16 17 18 19 20 21 22 4- epimerase of Brevibacterium lactofermentum ... GCGATCGCTGCCACTGC GCCGCCGCGCCAAGAACCA CCAGCGGCGTGTGCAGCGAGAT 1 12 0 Primer extension RT-PCR RT-PCR FEBS Journal 27 4 (20 07) 11 10 1 12 2 ª 20 07 The Authors Journal compilation ª 20 07 FEBS S Tunca et al ... Solid bars indicate the DNA fragments amplified by RT-PCR in the gene expression studies (see Fig 4) 11 12 FEBS Journal 27 4 (20 07) 11 10 1 12 2 ª 20 07 The Authors Journal compilation ª 20 07 FEBS S Tunca...
- 13
- 456
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... (mM )1 cm )1) 2P-AMP NADP+ Thio-NADP+ NADPO 3. 6 6 .3 2. 0 3. 0 0 .22 (48 9 nm) 1 .2 (49 9 nm) 0. 83 (49 6 nm) 1. 8 (49 4 nm) ± ± ± ± 0.7 0 .2 a Difference extinction coefficients at the wavelength indicated ... dinucleotides Anal Biochem 1 42 , 23 2– 23 4 Wong P, Bachki A, Banerjee K & Leyland-Jones B (20 02) Identification of N1-methyl -2- pyridone-5-carboxamide and N1-methyl -4- pyridone-5-carboxamide as components ... m ⁄ z 7 41 . 74 [MH–H2O]+, 6 24 . 71 [MH–adenine]+, 6 03. 66 [MH )4- oxo-nicotinamide– H2O]+, 48 9. 71 [MH )4- oxo-nicotinamide-ribose–H2O]+, and 32 9 .86 [MH )4- oxo-nicotinamide-ribose-diphosphate– H2O]+, amu...
- 10
- 406
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25