adding paragraphs a 1 introductory text a 1 i and a 1 ii and
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... template control A5 49 Protease TMPRSS13 is inhibited by HAI -1 TMPRSS13 HAI -1 HAI-1B HAI -1 GAPDH Fig RT-PCR analysis of TMPRSS13 and HAI -1 mRNA in human carcinoma cell lines Total RNA was isolated ... factor activator Eur J Biochem 229, 257–2 61 Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (19 89) Molecular cloning and ... inhibited by HAI -1 T Hashimoto et al characterized the inhibitory activity of HAI -1 against TMPRSS13 in detail Preparation and activation of a secreted form of pro-TMPRSS13 expressed in mammalian cells...
- 13
- 641
- 0
THERE ONCE WAS A CLASSICAL THEORY: Introductory Classical Mechanics, with Problems and Solutions pdf
... VIII -1 VIII -1 VIII -1 VIII-2 VIII-5 VIII-5 VIII-9 VIII -10 VIII -11 VIII -15 VIII -15 VIII -18 VIII-20 VIII-22 VIII-22 VIII-24 VIII-25 VIII-25 VIII-26 VIII-29 ... VII -1 VII-2 VII-3 VII-4 VII-5 VII-6 VII-7 VII-9 VII-9 VII -11 VII -12 VII -13 VII -13 VII -14 VII -17 VII -19 VII- 21 VII-28 VII-34 ... XI -19 XI-22 XI-24 XI-26 XI-30 XI-34 XII -1 XII -1 XII-2 XII-4 XII-6 XII-6 XII-6 XII-7 XII-7 XII-8 XII -10 XII -12 XII -13 XII -14 XIII -1 XIII -1 ...
- 623
- 464
- 0
8 De TN KT15 + D.A Chuong II 10 NC
... không hợp lệ file bị x a (violet.vn/uploads/resources/295 /11 0 714 //8DeTN %20DAKT15chuongII10NangCao.DOC) Quay trở http://violet.vn ...
- 2
- 267
- 0
Đe va Đ/a -HK II -K10 -NC (06-07)
... 10 Ch¬ng tr×nh n©ng cao §¸P ¸N Vµ BIĨU I M 10 11 12 A X B X X X C X X D X X X X X X PHÇn i Tr¾c nghiƯm (3,0 i m) M i c©u ®óng tÝnh: 0,25 i m PHÇn II Tù ln (7,0 i m) B i §¸p ¸n B i1 a + (a) ... c a mÉu sè liƯu B i 3: (3,0 i m) Trong mỈt ph¼ng to¹ ®é Oxy : Cho tam gi¸c ABC cã ®Ønh A( 1 ; ), ph¬ng tr×nh c a c¹nh BC: 3x + 4y +15 = a) ViÕt ph¬ng tr×nh tỉng qu¸t c a ®êng cao AH c a tam gi¸c ... kiĨm tra häc k× Ii, n¨m häc 2006-2007 M¤N: TO¸N - líp 10 Ch¬ng tr×nh n©ng cao Th i gian: 70 (kh«ng kĨ th i gian ph¸t ®Ị) - PHÇn II Tù ln (7,0 i m) Häc sinh...
- 4
- 244
- 0
Kt Giữa Kì II
... Đáp án Kiểm tra tiết Môn Đ a lí học kì A Phần trắc nghiệm(4đ) • Khoanh tròn ý (M i ý 0.5đ) Câu 1: b Câu 2: d Câu 3: c Câu 4: a • i n từ thích hợp (M i ý 0.5d) (a) quan trọng (b) ngập ... cháy rừng (d) sinh th i B Phần tự luận (6 đ) Câu 1: 2đ Học sinh trình bày được: -Đồng có diện tích gần triệu ha,đất phù sa 1. 2 triệu ha,đất phèn mặn 2.5 triệu (0,5 đ) -Khí hậu mang tính chất cận ... nhiều tiềm dầu khí (0,5đ) - Vùng nằm sát đường hàng h i quốc tế thuận l i cho việc giao thông đường biển (0,5đ) - Du lịch biển dịch vụ biển (0,5đ) Câu (2đ): Vẽ biểu đồ hình cột chồng a) Có ghi...
- 2
- 273
- 0
Bài giảng Kiem tra_Lan 1-II(06-07)
... h i sau, câu phát biểu nhất: A Oxit axit thường oxit kim lo i tương ứng v i oxit B Oxit bazơ thường oxit phi kim tương ứng v i bazơ C Oxit axit thường oxit kim lo i tương ứng v i axit D Oxit bazơ ... v i axit C Oxit bazơ thường oxit kim lo i tương ứng v i bazơ D Oxit axit thường oxit kim lo i tương ứng v i oxit Một oxit đồng có tỉ lệ kh i lượng Cu O oxit : Công thức h a học đơn giản oxit ... thường oxit phi kim tương ứng v i bazơ C Oxit bazơ thường oxit kim lo i tương ứng v i bazơ D Oxit axit thường oxit kim lo i tương ứng v i axit Nhận xét sau đúng: A Không khí hỗn hợp ch a nhiều nguyên...
- 4
- 122
- 0
Nghiên cứu phân bố phổ dao động trong dịch chuyển điện tử 1 1∑+ 3 1 II của nali luận văn thạc sỹ vật lý
... B i ba + B i ba B i ba + B i bốn B i bốn + B i bốn Trạng th i phân tử tương ứng B i đơn B i đ i B i ba B i đơn , B i ba B i đ i, B i bốn B i ba, B i năm B i đơn , B i ba, B i năm B i đ i, b i bốn, ... L Brion and R W Field, The spectra and dynamics of diatomic molecules, Elsevier 2004 [7] J Weiner, V S Bagnato and S Zilio, P S Julienne, Experiments and theory in cold and ultracold collisions, ... không triệt tiêu Trong quá trình dao động, khoảng cách giư a hai hạt nhân thay đô i nên ta có thể khai triển dhn theo chu i Taylor xung quanh khoảng cách cân bằng Re giư a hai hạt nhân...
- 37
- 418
- 0
Một số mô hình thế năng cho trạng thái 3 1 II của nali luận văn thạc sỹ vật lý
... 11 7 11 8 11 9 12 0 12 1 12 2 12 3 12 4 12 5 12 6 12 7 12 8 12 9 10 10 11 11 11 12 12 12 13 13 13 14 14 14 15 15 15 16 16 16 17 17 17 7 8 9 10 10 10 11 11 11 12 12 12 13 13 0 17 18 16 17 18 16 17 18 16 17 18 ... 40 41 v 0 1 2 3 5 6 7 8 9 10 10 10 11 11 11 12 12 12 13 13 13 14 14 J 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 10 11 E(v,J) 30095.57452 3 010 1.02752 3 010 7.28352 ... 17 18 16 17 18 16 17 18 16 17 18 16 17 18 16 18 16 18 16 17 18 16 17 18 16 17 18 16 316 17.75507 316 26 .12 507 316 35 .13 507 317 69.36507 317 77.56507 317 86.52507 319 19.08507 319 27.20507 319 36 .11 507...
- 57
- 294
- 0
Nghiên cứu các trạng thái kích thích 1 II và 1∑+ của phân tử nali bằng phương pháp phổ đánh dấu phân cực luận văn thạc sỹ vật lý
... Chemistry, Section C 89 (19 92) 353 - 4 71 [10 ] Z J Jabbour, J Huennekens, J Chem Phys 10 7 (19 97) 10 94 -11 05 [11 ] A Pashov, I Jackowska, W Jastrzebski, P Kowalczyk, Phys Rev A 58 (19 98) 10 48 -10 54 [12 ] ... th i cao tính đ i xứng 10 ∑ + [Na(3p) +Li(2p)] l i có sai số lớn khoảng 16 7cm -1 i u gi i trả l i hai câu h i: Thứ trạng th i 51 Πsẽ bị thiếu kết thực nghiệm Mặc dù thí nghiệm trước thực liên ... of electronic state of the NaLi molecule by polarization labelling spectroscopy ”, (2008), Luận văn tiến sĩ [5] C E Felows: The NaLi 11 ∑+ (X) electronic ground-state dissociation limit, J Chem...
- 42
- 500
- 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx
... BIAcore analysis of rhIGF1R binding by IGF analogues High af®nity binding of IGF -I, IGF -II and their analogues to rhIGF1R was measured by BIAcore analysis (Figs and 2), and relative binding af®nities ... 4E) and Arg6IGF -II and des (1 6)-IGF -II were essentially equipotent to IGF -II Leu27-IGF -II and des- (1 6 ,10 )-Leu27-IGF -II did not exhibit any survival-promoting effects at 10 nM (Fig 4E) Finally, ... expected to maintain rhIGF1R-binding af®nities similar to IGF -I Long Gly3-IGF -I and Long Arg3-IGF -I also had similar rhIGF1R-binding af®nities to IGF -I (data not shown) The analogues Leu24-IGF -I, des-(2,3)-Leu24-IGF -I, ...
- 8
- 482
- 0
Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot
... indicate the migration of carp apoA -I (27.5 kDa) and A- II (12 .5), respectively Table Bacteriostatic and bactericidal activities of carp apoA -I and A- II Each value in the table represents the mean ± SE ... there are a few studies of mammalian HDL and its principal apolipoproteins A- I and A- II in antimicrobial or antiviral activities in vitro [13 ,14 ,30], these proteins have not been yet recognized as ... more active than apoA -II, both major apolipoproteins contribute significantly to the antimicrobial activity displayed by carp plasma HDL Results Purification of HDL and apolipoproteins A- I and A- II...
- 7
- 397
- 0
German banks – a declining industry? Andreas Hackethal ppt
... proportion of sectors’ total financial assets and liabilities, respectively, that constitute claims on financial institutions (asset intermediation ratios) or liabilities vis-à-vis financial institutions ... provide a wide array of services to their primary institutions They act as clearing institutions, provide access to national and international financial markets, provide asset liability management ... information can be made available to all participants almost instantaneously and the participants' capacity to process this information has increased dramatically In addition, new instruments allow...
- 41
- 269
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... F-TDPX1 Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC ... Despite the fact that Leishmania 5644 spp are obligate intracellular parasites of macrophages, and therefore live in a potentially hostile oxidizing environment in the mammalian stage of their life ... Cys35Ala mutant is devoid of enzyme activity, indicating that Cys35 is involved in catalysis The Cys83Ala mutant shows only 1% of wild-type activity with TryX indicating that formation of an intramolecular...
- 16
- 483
- 0
Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx
... markedly into the active cleft compared to Loop II in TVA II (Fig 5B) In most a- amylases, loop II makes a large bank in the active cleft, as in CGTase and TAA In contrast, loop II of TVA II Fig ... loop is connected with domain B Loop II is located at the end of the active cleft and forms a ÔdamÕ-like bank In TAA and CGTase, loop II is 10 and 14 residues longer than that in TVA II, and protrudes ... TVA II and a pullulan model substrate by using partial hydrolyates of pullulan and an inactive TVA II mutant, D325N A hexasaccharide containing two panose units, 43 -a- panosylpanose (43-P2) (Fig...
- 9
- 361
- 0
50 điều nên làm ở châu Á - Phần II docx
... văn h a gi i Miến i n Thử vị cay vị chua Miến i n Hai lo i gia vị tưởng chừng có ớt chanh Thế nhưng, đến đây, bạn khó mà xác định lo i rau củ Tham quan Bagan Quần thể kiến trúc Bagan rộng 32 ... Phật Giáo lịch sử Punakha Dzong Ng i ch a đặc biệt mang màu sắc Tây Tạng N i diễn kiện trị quan trọng nhà vua lên vào năm 19 07, n i cử hành hôn lễ vua ch a, chọn thủ đô 19 60, họp quốc h i đầu tiên… ... thung lũng Kathmandu Khi vào tham quan đền, bạn ph i chân trần sử dụng nến để dâng lễ cầu may mắn Bay qua dãy n i Himalayas lúc bình minh Đây khoảnh khắc đáng nhớ đ i bạn Hãy liên hệ v i dịch vụ...
- 11
- 363
- 0
Báo cáo khoa học: Mutational analysis of a type II thioesterase associated with nonribosomal peptide synthesis pdf
... GAT GAG CTG TG TEIIsrfH8 5A TEIIsrfS8 6A TEIIsrfS86C TEIIsrfS 11 2A TEIIsrfD16 3A TEIIsrfD18 9A TEIIsrfD19 0A TEIIsrf DD189 /19 0AA TEIIsrfH 216 L GTG CTG TTC GGA GCC AGT ATG GGC GGA ATG ATC AC GT GAT CAT ... Ser and His is required for catalysis In this study, we describe a mutational analysis and mechanistic investigations of the microbial TEIISrf (242 amino acids, 28 kDa), which is associated with ... residues among TEIIs involved in microbial secondary metabolism, 15 amino-acid sequences of NRPS and PKS TEIIs as well as the mammalian TEIIrat were aligned A catalytic role for Ser1 01, Asp236 and His237...
- 10
- 357
- 0
tutorial 1 basic android setup windows 2
... having grasped the fundamentals of building and running an Android application, we will create a more complicated project involving the onboard camera and real-time image processing Create a ... start writing image processing programs that can run an Androidcompatible mobile device Hello World Example First, we will build a simple Android program in Eclipse This simple example will also ... click “Finish” In the Android SDK Manager that pops up, check at least the following boxes under “Packages”: Tools, Android 3.0, Android 2.3, Android 2.2, Android 2 .1, Android 1. 6, Extras Click...
- 8
- 392
- 0
tổng hợp, nghiên cứu cấu trúc và thăm dò hoạt tính sinh học của phức tạo thành giữa cu(ii) và bazơ schiff đi từ isatin và 8 - aminoquinoline
... [ZnCl2L] (Zn(IV),H2L: etylenđiamine-bis(isatin) Trong công trình [36], [37] tác giả tổng hợp xác định cấu trúc Ru(III), Rh(III), Ir(III) v i bazơ Schiff isatin sau: M= Ru(III), Rh(III), Ir(III); R=(CH2)2, ... in Relation to IR Data of some Schiff Base Complexes of Transition Metals and their Biological and pharmacological Studies”, Inorganica Chimica Acta, 15 1, pp 2 01- 208 37 Quartarone G., Bellomi ... “Syntheses and spectroscopic studies on zinc (II) and mercury (II) complexes of isatin-3thiosemicarbazone”, Journal of Inorganic Biochemistry, 6 41 (1) , pp 17 -22 22 Bacchi A. , Carcelli M., Pelagatti P.,...
- 48
- 774
- 3
Bài 1 hello android
... hệ i u hành ● Phiên 1. x: Android 1. 0 (API 1) Android 1. 1 (API 2) Android 1. 5 Cupcake (API 3) Android 1. 6 Donut (API 4) ● Phiên 2.x: Android 2.0 Eclair (API 5) – Android 2.0 .1 (API 6) ... 4.0.2 Ice Cream Sandwich (API 14 ) Android 4.0.3 – 4.0.4 Ice Cream Sandwich (API 15 ) Android 4 .1 Jelly Bean (API 16 ) Android 4.2 Jelly Bean (API 17 ) Android 4.3 Jelly Bean (API 18 ) Android ... 4.4 Kit Kat (API 19 ) Lập trình Android (2 014 ) - B i Hello Android 1. 2 Android hệ sinh th i Hệ sinh th i Lập trình Android (2 014 ) - B i Hello Android 1. 2 Android hệ sinh th i Hệ sinh th i Lập...
- 22
- 189
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008