a new approach to the gagging problem
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing...
- 8
- 522
- 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... from the Sandia National Laboratory study on enter-prise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into ... one hand, the manager is told that wasting the tax-payers’ dollars must stop; on the other hand, the public manager is told to do more with less. A cry heard around the globe is that government ... appropriate transforma-tion perspectives. ese are the philosophical underpinnings of change initiatives, and they serve as approaches to framing the planned change to fit into the technical and...
- 288
- 2,415
- 0
A new approach to financial regulation: the blueprint for reform potx
... recognising that the regulators are best placed to determine the nature of the regulatory action which should be taken. The same arrangements will also apply to the FCA. Governance 2.68 As with the ... refers to the PRA’s assessment of the risk to financial stability as a whole. It is likely that the PRA will consult the FPC in making this assessment. Condition (b) allows the PRA to veto the action ... ensure that the powers available under the Part 18 regime can be used more efficiently and that the FCA (and the Bank in relation to RCHs) can act more responsively to the more complex and challenging...
- 413
- 413
- 0
A New Approach to Quantum Theory
... there was a great obstacle to this delayedaction-at -a- distance theory: namely, if a radiating electron, say inan atom or an antenna, were not acted upon at all by the field thatit radiated, then ... leaves the action invariant(for example, the transformation may be a rotation). The trans-formation is to contain a parameter, a, and is to be a continuousfunction of a. Fora equal to zero, the ... radiationof an atom in quantum mechanics also, may not be spontaneousat all, but induced by the interaction with other atoms, and thatall of the apparent quantum properties of light and the...
- 142
- 574
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and the study of language universals. ... Nga – K 1 1A 30Graduation paperDeclarationTitle: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... 2.2.2 Gradable and non- gradable adjectivesAccording to L. G. Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable. Gradable adjectives mean a large class of...
- 44
- 1,746
- 7
Partnering: A New Approach to Sexual and Reproductive Health doc
... perspectives: the father as symbolic function, the father as a legalinstitution and the father as a biological fact. The first refers to the psychological, tra d i t i o n a l ,c u l t u ral and historical ... “implies a positive approach to human sexuality” and mandates that sexualhealth care should be the enhancement of life and personal relationships and not merely the counselling and care related to ... communication, 20 October 2000. Chapter 1S The Masculinity EquationPartnering: A New Approach to Sexual and Reproductive Health, 2001, Technical Paper No .3, UNFPA, New YorkPartnering: A New Approach...
- 196
- 505
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation ofhigh molecular mass...
- 11
- 731
- 0
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx
... tool.3Or˘asan et al. (2000) enhanced the preference-based anaphora resolution algorithmsby using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the opti-mal combination ... Extractor), a new approach to multilingualsingle-document extractive summarization wheresummarization is considered as an optimization or a search problem. We use a Genetic Algorithm(GA) to ... not be applied too often,because then GA will in fact change to randomsearch. Our mutation operator includes a proba-bility (3%) that an arbitrary weight in a vector willbe changed by a uniformly...
- 10
- 598
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... Evaluation, pages 719- 724. Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto Nagao. 1998. Construction of Japanese nominal semantic dictionary using " ;A ... a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus word for a head word, like a person ... 'book-Ace' yomu 'read' Agent senmonka 'expert' no chousa 'study' kare-ga 'he-NOM' yomu 'read' Possession watashi 'I' no kuruma...
- 8
- 553
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008