a natural language system for spoken language applications
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... this paper describes the lexicon, grammar, and semantics of English, Gemini has also been used in a Japanese spo- ken language understanding system (Kameyama, 1992). 2.1. Grammar Formalism ... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form information....
- 8
- 376
- 0
Tài liệu Báo cáo khoa học: "A Phonotactic Language Model for Spoken Language Identification" pptx
... Recognition Evaluation (LRE) data. The database was intended to establish a baseline of performance capability for language recognition of conversational tele-phone speech. The database contains recorded ... 515–522,Ann Arbor, June 2005.c2005 Association for Computational Linguistics A Phonotactic Language Model for Spoken Language Identification Haizhou Li and Bin Ma Institute for Infocomm Research ... identification us-ing Gaussian Mixture model tokenization, in Proc. of ICASSP. Yonghong Yan, and Etienne Barnard. 1995. An ap-proach to automatic language identification based on language dependent...
- 8
- 436
- 0
Báo cáo khoa học: "A Preference-first Language Processor Integrating the Unification Grammar and Markov Language Model for Speech Recognition-ApplicationS" potx
... Lee, L. S. et al. (1990). A Mandarin Dictation Machine Based Upon A Hierarchical Recognition Approach and Chinese Natural Language Analysis, IEEE Trans. on Pattern Analysis and Machine Intelligence, ... grammars, compared with other grarnmal~cal approaches, are more declarative and can better integrate syntactic and semantic information to eliminate illegal combinations; while Markov language ... unification granunar and Markov language model are integrated in a word lattice parsing algorithm based on an augmented chart, and the island-driven parsing concept is combined with various...
- 6
- 392
- 0
Tài liệu Xử lý tiếng nói - Spoken Language System Architecture docx
... điệuc a âm thanhnhiềungữ điệuc a âm thanhnhiều ngữ điệu c a âm thanhnhiều ngữ điệu c a âm thanh Thành phần quản lý hội thoại có chức năng Thành phần quản lý hội thoại có chức năng giao tiếp ... chuyển đổi kết quả nhận dạng tiếng nói sang dạng ngữ ngh a đượcquyướcnói sang dạng ngữ ngh a đượcquyướcnói sang dạng ngữ ngh a được quy ướcnói sang dạng ngữ ngh a được quy ước Bài 3:Bài 3:Kiến trúc ... vị tác động c a nhiễucáchphátâmâm, âm vị, tác động c a nhiễu, cách phát âm âm, âm vị, tác động c a nhiễu, cách phát âm c a nhiều người nói khác nhauc a nhiều người nói khác nhau–– Các mô hình...
- 12
- 560
- 3
Tài liệu Báo cáo khoa học: "Exploiting Non-local Features for Spoken Language Understanding" pptx
... and a data-driven approach. Traditionally, information ex-traction and language understanding fields haveusually used a syntactic parser to encode globalinformation (e.g. parse tree path, ... Incorporating Non-local Information3.1 Using Trigger FeaturesTo exploit non-local information to sequential la-beling for a statistical SLU, we can use two ap-proaches; a syntactic parser-based and ... long-distance de-pendencies to improve performance on thestatistical spoken language understanding(SLU) problem. The statistical natural language parsers trained on text performunreliably to...
- 8
- 396
- 0
Báo cáo khoa học: "Re-Ranking Models For Spoken Language Understanding Marco Dinarelli University of Trento Italy" potx
... Understanding aims atmapping a natural language spoken sen-tence into a semantic representation. Inthe last decade two main approaches havebeen pursued: generative and discrimi-native models. ... European Chapter of the ACL, pages 202–210,Athens, Greece, 30 March – 3 April 2009.c2009 Association for Computational LinguisticsRe-Ranking Models For Spoken Language UnderstandingMarco DinarelliUniversity ... and 180 Human-Human (HH) dialogs areavailable. Statistics on LUNA corpus are reportedin Table 1.The corpus MEDIA was collected withinthe French project MEDIA-EVALDA (Bonneau-Maynard et al.,...
- 9
- 330
- 0
Báo cáo khoa học: "Bilingual-LSA Based LM Adaptation for Spoken Language Translation" pot
... adaptation across languages, enabling theadaptation of a LM from one language based on theadaptation text of another language. In statisticalmachine translation (SMT), one approach is to ap-ply ... 2007.c2007 Association for Computational LinguisticsBilingual-LSA Based LM Adaptation for Spoken Language TranslationYik-Cheung Tam and Ian Lane and Tanja SchultzInterACT, Language Technologies ... tar-get language N-gram LM via marginal adap-tation. The proposed framework also en-ables rapid bootstrapping of LSA models for new languages based on a source LSAmodel from another language. ...
- 8
- 279
- 0
Báo cáo khoa học: "Robust, Finite-State Parsing for Spoken Language Understanding" pdf
... understanding systems typically pass the transcript produced by a speech rec- ognizer into a natural language parser with no integration of acoustic and grammatical con- straints. One reason for ... Finite-State Parsing for Spoken Language Understanding Edward C. Kaiser Center for Spoken Language Understanding Oregon Graduate Institute PO Box 91000 Portland OR 97291 kaiserâcse, ogi. edu Abstract ... Power of Regular Grammars Tomita (1986) has argued that context-free grammars (CFGs) are over-powered for natu- ral language. Chart parsers are designed to deal with the worst case of very-deep...
- 6
- 236
- 0
A Fast File System for UNIX
... data, and possibly a single fragmented block. If a file system block must be fragmented to obtain space for a small amount of data, the remaining fragments of the blockare made available for allocation ... the data throughput rates that many applications require. For example, applications such as VLSI design and image processing do a small amount of processing on a large quanti-ties of data and ... blocks that a user may allocate. A separate quota can be set for each user on eachfile system. Resources are given both a hard and a soft limit. When a program exceeds a soft limit, a warn-ing...
- 14
- 1,023
- 0
A web-based system for notifying environment violation.doc
... that contains all logic data of application. Separating logic data from application into it will make program scalable and higher performance.Most of web applications today use Relational Database ... operating system. - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily.- Quick delivery: web-based model make it portable to ... load data from the system because only a part of web page is updated. It does not need to load entire web page.- Access management: each user can access content and use many features that are...
- 56
- 410
- 0
Tài liệu A Knowledge Management System for ERP Implementation pdf
... proposedthat consists of cooperative working platform,consulting platform, individual KM platform ,organizational KM platform, and knowledgetransfer platform. This system can effectivelymanage ... addition, the same question can be askedagain and again and the quality of the answerscan not be guaranteed. Therefore, the organiza-tion can have personnel in charge of monitoringand tracking questions ... Venkataramanan M. 2003. Enter-prise resource planning: managing the implementa-tion process. European Journal of Operational Research146: 302–314.Motwni J, Mirchandani D, Madan M, Gunasekaran...
- 12
- 622
- 1
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
- 9
- 444
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Pharmaceutical University, 5 Nakauchi-cho, Misasagi,Yamashina-ku, Kyoto 607-8414, Japan.Fax: + 81 75 595 4758, Tel.: + 81 75 595 4653,E-mail: hatayama@mb.kyoto-phu.ac.jpAbbreviations: SA, ... cyclooxygenase and nuclear factor-kappa Bactivation [9,10]. In addition to the anti-inflammatoryeffects, it is noteworthy that SA which can activate HSFFig. 4. Effect of SA on accumulation ofHsp105 and ... simplescreening system for stress response modulators in mammalian cellsKeiichi Ishihara, Kenji Horiguchi, Nobuyuki Yamagishi and Takumi HatayamaDepartment of Biochemistry, Kyoto Pharmaceutical University,...
- 8
- 470
- 0
Lore: A Database Management System for Semistructured Data ppt
... OA7)Scan(OA1,"Publications",OA6)CreateSet(OA4, OA5)Scan(OA1,"Name",OA4)SetOp(Union,OA5,OA6, OA7)Select(OA3 = TRUE)Aggr(Exists, OA2, OA3)Select(OA2 = "CS")Scan(OA1,"Dept",OA2) ... DataManagerQueryOptimizerQuery PlanGeneratorPreprocessing(Lorel to OQL)ParsingHTML GUITextualInterfaceAPI Applications Lore System Queries Select(OA3 = TRUE)Aggr(Exists, OA2, OA3)Select(OA2 ... )Scan(OA1,"Dept",OA2)JoinScan(OA0,"Member",OA1)Scan(Root,"DBGroup",OA0)JoinJoinScan(OA0,"Member",OA1)Scan(Root,"DBGroup",OA0)JoinFrom clauseFrom and Where clausesFinal Query PlanScan(OA0,"Member",OA1)Scan(Root,"DBGroup",OA0)JoinJoinProject(OA7)Aggr(Count, OA6, OA7)Scan(OA1,"Publications",OA6)CreateSet(OA4,...
- 13
- 270
- 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... not readily available (Zhao etal., 2010).In contrast, bilingual parallel data is in abundanceand has been used in extracting paraphrase (Ban-nard and Callison-Burch, 2005; Zhao et al., 2008b;Callison-Burch, ... issues are also raisedin (Zhao and Wang, 2010) about using automaticmetrics: paraphrase changes less gets larger BLEUscore and the evaluations of paraphrase quality andrate tend to be incompatible.To ... and William B. Dolan. 2011. Collectinghighly parallel data for paraphrase evaluation. In ACL,pages 190–200.David Chiang. 2007. Hierarchical phrase-based transla-tion. Computational Linguistics,...
- 5
- 347
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25