a key kinase involved in toll like receptor signaling and resistance to bacterial infection
Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt
... pro- and anti -in ammatory cytokine production [25] Recently, this pathway was shown to have an essential role in inflammation and immune cells [25] In particular, many groups have shown that GSK3b-b-catenin ... macrophages, and that the ROS produced are part of an important process controlling foam cell formation [24] Glycogen synthase kinase (GSK3)b and the b-catenin pathway are crucial regulators in the balance ... macrophages and contributes to foam cell formation These studies suggest a crucial role for Nox1 in TLR-mediated signaling pathways and its importance in innate immunity and in ammatory responses...
- 8
- 340
- 0
Báo cáo y học: "A novel model of common Toll-like receptor 4- and injury-induced transcriptional themes in human leukocytes" pot
... Chronobiol Int 2007, 24:1009-1034 43 Takimoto M, Hamada A, Tomoda A, Ohdo S, Ohmura T, Sakato H, Kawatani J, Jodoi T, Nakagawa H, Terazono H, Koyanagi S, Higuchi S, Kimura M, Tukikawa H, Irie S, Saito ... change) in PBL obtained from healthy subjects at six hours after challenge with in vivo endotoxin, and in trauma patients studied within to 12 days after admission, as compared to baseline healthy ... Identification of oxidative stress and Toll- like receptor signaling as a key pathway of acute lung injury Cell 2008, 133:235-249 15 Gill R, Tsung A, Billiar T: Linking oxidative stress to inflammation:...
- 11
- 252
- 0
Báo cáo y học: "Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus" pps
... cleavage of DNA, and histone phosphorylation are just a few modifications that may result in increased TLR stimulation and ‘adjuvanticity’ Toll- like receptors and interferons in lupus Although at ... inefficient, failing to deliver high enough intracytoplasmic concentrations • Inhibitory DNA motifs: mammalian DNA, in contrast to bacterial DNA, contains a higher frequency of inhibitory DNA ... secretion may be important for downregulating the endotoxin-induced inflammatory cytokine storm that characterizes early stages of bacterial sepsis In addition, IL-10 may also finely modulate the activity...
- 11
- 552
- 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... proinflammatory markers in macrophages, adipocytes, and liver leading to insulin resistance Insulin resistance is a main pathological abnormality associated with metabolic syndrome, obesity, and ... that saturated fat diet-induced insulin resistance was blunted in mice that lacked functional TLR4 It is likely that saturated fat and trans fat induce Page of inflammation and insulin resistance ... complex and involves CD-14 and the adaptor proteins, MD-2 and myeloid differentiation factor-88 (MyD88) The process recruits interleukin-1 receptor- associated kinase (IRAK) leading to the activation...
- 7
- 272
- 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... proinflammatory markers in macrophages, adipocytes, and liver leading to insulin resistance Insulin resistance is a main pathological abnormality associated with metabolic syndrome, obesity, and ... that saturated fat diet-induced insulin resistance was blunted in mice that lacked functional TLR4 It is likely that saturated fat and trans fat induce Page of inflammation and insulin resistance ... complex and involves CD-14 and the adaptor proteins, MD-2 and myeloid differentiation factor-88 (MyD88) The process recruits interleukin-1 receptor- associated kinase (IRAK) leading to the activation...
- 7
- 238
- 0
The role of downstream of kinase (DOK) 3 in toll like receptor signalling
... tyrosine kinase TAK-1 TGF--activated kinase TANK TRAF family member-associated NFB activator TBK1 TANK Binding Kinase- 1 TIR Toll/ IL-1 receptor domain TIRAP Toll/ IL-1R domain-containing adaptor ... signalling, TRIF can also interact with the TNF receptor- associated factor (TRAF3) that subsequently activates downstream IKK-related kinases, TANK-binding kinase (TBK1) and inhibitor of kB kinase ... Protein TLR Toll- Like Receptors TNIP1 TNFAIP3 interacting protein TNF Tumor necrosis factor- TRAF TNF receptor- associated factor TRAM TRIF-related adaptor molecule TRIF TIR-containing adaptor inducing...
- 177
- 285
- 0
Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot
... GCAAGCTGCGGAAGATAATG CGCAGCTCTCAGATTTACCC TLR3 GAATGTTTAAATCTCACTGC AAGTGCTACTTGCAATTTAT TLR4 ATGAAATGAGTTGCAGCAGA AGCCATCGTTGTCTCCCTAA TLR5 GTACAGAAACAGCAGTATTTGAG TCTGTTGAGAGAGTTTATGAAGAA TLR6 TTTACTTGGATGATGATGAATAGT ... CAACGATAGGCGTAAATGTG GAACCTCGAGACTCTTCATTT TNF -a CTCCACCCATGTGCTCCTCA CTCTGGCAGGGGCTCTTGAT IL10 CAACAGAAGCTTCCATTCCA AGCAGT TAGGAAGCCCCAAG IL6 AATAATAATGGAAAGTGGCTATGC AATGCCATTTATTGGTATAAAAAC b-Actin ... TTTACTTGGATGATGATGAATAGT AGTTCCCCAGATGAAACATT TLR7 TLR8 CCATACTTCTGGCAGTGTCT AAGAGCTCCATCCTCCAGTG ACTAGGCAGTTGTGTTTTGC CCGTGAATCATTTTCAGTCAA TLR9 GGGACAACCACCACTTCTAT TGAGGTGAGTGTGGAGGT TLR10 CAACGATAGGCGTAAATGTG...
- 15
- 375
- 0
Báo cáo y học: " CpG oligonucleotide activates Toll-like receptor 9 and causes lung inflammation in vivo" ppsx
... finding that an intraperitoneal application of CpG-ODN (extrapulmonary stimulus) leads to a systemic and local inflammatory response in WT mice, which was abolished in TLR9-D animals Our data ... paraffin and cut into μm sections Hematoxylin and Eosin (H&E) staining was performed using standard protocols and leukocyte accumulation was quantified A total of ten microscopic fields covering mm2 ... CpG-ODN and pulmonary inflammation Therefore, we injected bacterial DNA intraperitoneally to answer the question whether bacterial DNA induces lung inflammation in a TLR9-dependent manner Methods Animals...
- 9
- 233
- 0
Báo cáo y học: " Human herpesvirus 6 infection impairs Toll-like receptor signaling" pptx
... Poway, CA, USA), anti-TRAF6 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-TAK-1 (Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated IκB kinase α/β (IKKα/β) (Cell Signaling ... 242:540-546 19 Zandi E, Rothwarf DM, Delhase M, Hayakawa M, Karin M: The IκB kinase complex (IKK) contains two kinase subunits, IKKα and IKKβ, necessary for IκB phosphorylation and NF-κB activation Cell ... Young DB, Barbosa M, Mann M, Manning A, Rao A: IKK-1 and IKK-2: cytokineactivated IκB kinases essential for NF-κB activation Science 1997, 278:860-866 23 Chen RA, Ryzhakov G, Cooray S, Randow F,...
- 5
- 185
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... stress-activated protein kinase/ c-Jun N-terminal kinase (SAPK/JNK) (37) MAPKs are important for intracellular signal transduction and play critical roles in regulating neural plasticity and inflammatory ... cascades (36) The NF-kB cascade leads to release pro-inflammatory cytokines (IL-6, IL-1β, TNF-α) The MAPK kinases activate extracellular signal-regulated kinase (ERK), p38 MAPK, and stress-activated ... p38 mitogen-activated protein kinase (p38 MAPK), extracellular signal-regulated kinase (ERK) and c-jun N-terminal kinase (JNK) during hypoxia in cerebral cortical nuclei of guinea pig fetus at term:...
- 9
- 487
- 0
báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf
... used in the study: caspase-3: 5'gggcctgaaataccaagtca-3' and 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and ... fragmentation factor CASP2 and RIPK1 adaptor domain containing protein Fas-associated death domain Fas apoptotic inhibitory molecule Helicase lymphoid specific Interleukin 10 MAP kinase interacting ... death agonist BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC22 domain family Cell-death inducing DNA...
- 7
- 507
- 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... express toll- like receptors and are activated by lipopolysaccharide J Exp Med 2003, 197:403-411 Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kitamura T, Kosugi A, Kimoto M, Miyake ... inflammatory cytokines Explanation for the involvement of Toll- like receptor (TLR)-2 on pre-activated T cells in pathogen-induced chronic inflammatory joint diseases Any diseases inflammation will cause ... inflammatory joint diseases inflamed joint activated and memory T cells can pass endothelial barriers TLR ligands can activate T cells independent of antigenic specificity release of inflammatory...
- 14
- 505
- 0
Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-B pathway doc
... frontiers in comparative cardiovascular pathology Cardiovasc Res 2007, 73:26-36 Kuwahara F, Kai H, Tokuda K, Niiyama H, Tahara N, Kusaba K, Takemiya K, Jalalidin A, Koga M, Nagata T, Shibata R, Imaizumi ... polyclonal antibody, anti-rat TNF -a antibody, anti-rat TNF -a receptor antibody (a neutralizing antibody, R&D Systems), polyclonal anti-p38 MAP kinase and monoclonal anti-phospho p38 MAP kinase antibodies ... cardiovascular diseases Cardiovasc Res 2003, 60:58-67 Caso JR, Pradillo JM, Hurtado O, Lorenzo P, Moro MA, Lizasoain I: Toll- like receptor is involved in brain damage and inflammation after experimental...
- 13
- 289
- 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... domain-containing adaptors and TLR signaling MyD88 is an essential TIR domain-containing adaptor for the induction of inflammatory cytokines via all the TLRs TIRAP/Mal is a second TIR domain-containing ... consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and TAB2 TAB2, an adaptor linking TAK1 to TRAF6, is associated with cell membrane under unstimulated ... enzymes involved in galactose utilization GAL4 contains a DNA binding domain (BD) (Keegan et al., 1986) and a transcription activation domain (AD) (Brent and Ptashne, 1985) which are separately...
- 236
- 494
- 0
Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus influenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt
... in uenzae-induced Toll- like receptor expression via an Src-dependent p38 mitogen-activated protein kinase signaling pathway J Biol Chem 280, 36185–36194 Shuto T, Imasato A, Jono H, Sakai A, Xu H, Watanabe ... [32] All cells were maintained at 37 °C in an atmosphere of 5% CO2 Bacterial strains and culture conditions Real-time Q-PCR analysis NTHi strain 12, a clinical isolate, was used in this study Bacteria ... interacts with TRAF6, we investigated if IRAK-1 and TRAF6 are also involved in TLR7 induction As shown in Fig 2F, coexpressing dominant-negative IRAK-1 or TRAF6 but not TRAF2 inhibited NTHi-induced...
- 14
- 366
- 0
Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc
... recruit kinases, IL-1R-associated kinase (IRAK)-1 and ⁄ or IRAK-2 [8], which in turn activate TNF receptor- associated factor 6-dependent signalling cascades, culminating in NF-jB activation [9] and ... signal transduction The LPS signalling cascade involves a lot of adapter molecules, such as MyD88 [7] and Toll receptor IL-1R domain-containing adapter protein (TIRAP) ⁄ MyD88 adapter -like (Mal) ... that recruitment of the adaptors involved in TLR signalling could lead to the activation of multiple intracellular cascades, including extracellular signal-regulated kinases, c-Jun N-terminal kinases,...
- 14
- 202
- 0
Báo cáo sinh học: " Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" potx
... JG, AB, CW and GL participated in collection and assembly of data CP and AS participated in data analysis and interpretation CB, HSB, AB and AS wrote the manuscript All authors read and approved ... 15 Santini D, Angeletti S, Ruzzo A, Dicuonzo G, Galluzzo S, Vincenzi B, Calvieri A, Pizzagalli F, Graziano N, Ferraro E, Lorino G, Altomare A, Magnani M, Graziano F, Tonini G: Toll- like receptor ... staining (Figure 1; Table 3) TLR4 staining (all scores) showed a diffuse and fine granular cytoplasmatic pattern Distinct membrane staining was observed in some tumors but never without cytoplasmatic...
- 9
- 335
- 0
báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx
... known inflammatory agent in brain that is activated after TLR-4 activation is the pro-inflammatory cytokine IL-1b [6] In this particular stress model, an increase in IL-1b mRNA levels was also ... circulating Gram-negative enterobacteria, which are a major source of LPS and can activate brain TLR-4 inducing a neuroinflammatory response In order to clarify the origin of stress-induced activation ... COX-2 in control and after CMS in the brain (A) Brain levels of the pro-inflammatory prostaglandin PGE2 (B), the anti-inflammatory one 15d-PGJ2 (C), and interleukin-1b (IL-1b) mRNA levels in control...
- 14
- 422
- 0
Báo cáo hóa học: " Differential inhibition of human cytomegalovirus (HCMV) by toll-like receptor ligands mediated by interferon-beta in human foreskin fibroblasts and cervical tissue" pdf
... 5-GCATTCGGAATCTGTCTCTG-3, R 5-ATTCCTGGCCTGTGAGTTCT-3); TLR4 (F 5-GATGCCAGGATGATGTCT-3, R 5-CCGCAAGTCTGTGCAATA-3); TLR9 (F 5-TACCTTGCCTGCCTTCCTAC3, R 5-CAACACCAGGCCTTCAAGAC-3); and GAPDH (F 5-GAAGGTGAAGGTCGGAGTC-3, ... currently understood although inflammatory changes caused by STI could influence HCMV infection Inflammation in genital tract infections is in many cases caused by the activation of genital tract cells ... Ligands induce IL-8 secretion TLR in Ectocervical explant tissue and inhibit HCMV infecTLR Ligands induce IL-8 secretion and inhibit HCMV infection in Ectocervical explant tissue A Ectocervial...
- 10
- 481
- 0
Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf
... http://www.virologyj.com/content/5/1/140 Table 1: Primers for real-time PCR Primer Sequence (5'> 3') TLR2 Forward Reverse CAGGGCTCACAGAAGCTGTAA GCCCAGGGAAGAAAAAGAATC TLR3 Forward Reverse TAGCAGTCATCCAACAGAATCAT AATCTTCTGAGTTGATTATGGGTAA ... L: A4 6R and A5 2R from vaccinia virus are antagonists of host IL-1 and toll- like receptor signaling Proc Natl Acad Sci USA 2000, 97:10162-10167 Harte M, Haga I, Maloney G, Gray P, Reading P, Bartlett ... experimental infections and the statistical analyses, and drafted the manuscript RKM participated in the PCR and protein assays HK participated in the PCR assays EB, HSK, MW and TV participated in the...
- 11
- 361
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu