a gender balanced approach to the study of childhood aggression and reciprocal family influences
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
... Preface For reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see as an unbridgeable divide between the humanities and the natural sciences ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... “religious” and then some We can consider specialness both behaviorally and substantively, asking if there are behaviors that tend to mark things off as special and if there are particular types of things...
- 229
- 1,453
- 0
Báo cáo y học: "A targeted lipidomics approach to the study of eicosanoid release in synovial joints" pdf
... data analysis and performed the statistical analysis PRvW participated in the design and coordination of the study and helped to draft the manuscript All authors read and approved the final manuscript ... (16,16dimethyl-PGF 2a) was prepared in ethanol (2 ng/μL) and was added to all composite standards at a final concentration of 100 pg/μL Chromatograms for standards were used to establish characteristic ... (16,16-dimethyl-PGF a) were calculated and plotted against the concentration of the calibration standards Calibration lines were calculated by the least squares linear regression method Sample collection and storage...
- 12
- 433
- 0
báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx
... CU914524.3 and the potato BAC AC233501.1 Representation of the co-linearity between the tomato BAC CU914524.3 and the potato BAC AC233501.1 The BAC CU914524.3 from tomato and the BAC AC233501.1 ... mapped onto the BAC CU914524.3 from tomato and the BAC AC233501.1 from potato The two BACs are present schematically at the center of the figure and were selected because they share a remarkable ... EST/TC alignments along the tomato and the potato genomes The mapping of Solanaceae ESTs certainly provides insights into the location of potential candidate genes and facilitates EST-driven gene annotation...
- 16
- 298
- 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf
... that it will walk away.’ Sem: ‘Kla goes out to seek Laay in the cane field and he finds that it is about to walk away.’ The sentence in (17) are split into two SVCs: the series of V1 to V3 and the ... variable quantification to resolve pro-forms and VP ellipses to their antecedents The variable quantification in TLG is comparable to the use of memory in storing antecedents and anaphora The verbs ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are...
- 9
- 572
- 0
Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt
... into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties which offers the ... is the guy at the door and the speaker and the relationship of the speaker having told the guy at the door to watch out The word but can be viewed as function mapping situation-types into situatiun-types ... st - and can be regarded as representing the Iocutionary aspect of the act The other gives the set of situation-types of the diseoursc situation (including author and reader or speaker and addressee)...
- 4
- 489
- 0
Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc
... Hague for other systems to which we can compare them We take this level of success as an indication of the feasibility of our data-driven, modular approach Additionally, our approach has the advantage ... Data The data on which the classifiers are trained and tested is an extract of 7915 sentences from the Penn Treebank (Marcus et al., 1993), which are tagged to indicate the location of WH gaps ... the VP node Finally, within the VP subtree it should predict the location of the gap as the last child of the parent VP SBARQ - begin at the first branching node dominating the WH operator, and...
- 4
- 614
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately ... for all x, y Î X and all n Î N, that is, d(T n f , T n+1 f ) ≤ same reasoning of the proof of Theorem 2.3, we have Ln+2 16 < ∞ for all n Î N By the Bae and Park Journal of Inequalities and Applications ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the functional Equation 1.1 for the case that X and Y are real...
- 7
- 429
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical ... “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 D G Bourgin, “Classes of transformations and bordering transformations,”...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx
... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 [11] J B Diaz and B Margolis, A fixed point theorem of the ... 143–190, 1995 [5] P G˘ vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp...
- 9
- 278
- 0
Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf
... out to be a natural alternative to the MAP approach proposed by Foulley and Gianola !8! The main advantage of the MAP approach lies in both its conceptual and computational simplicity Part of ... effects is the quasi-score approach of Me Cullagh and Nelder [30] which only requires the mean and variance of the data distribution In particular, an appealing version of the quasi-score approach for ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13...
- 18
- 297
- 0
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc
... separated the patient and professional groups in order to facilitate frank discussion, and broad and rapid brainstorming To maximize the richness and depth of the data obtained, we used a nominal ... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation to a range of possible interpretations and applications of a tool, there are development ... interpretation of data at the group level to interpretation at the individual level usually requires additional technical analysis as well as a body of evidence about the meaning and behavior of each...
- 39
- 387
- 0
A semi parametric approach to the pricing of basket credit derivatives
... birth dates, the revenue of a family and the number of cars they own, and the profits generated by a bank in France and in Singapore A full study of the theory of correlation is not the subject of ... price of the nth -to- default standard Basket CDS as a function of n, the number of defaults before the payment is made 77 Evolution of the price of the 1st -to- default standard Basket CDS as a function ... empirical data the i-th order statistic is the i-th smallest value of a statistical sample 42 2.3.1 Concordance Informally, the concordance of a pair of random variables measures if ‘large’ values of...
- 96
- 292
- 0
Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg
... Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 L C˘adariu and V Radu, “On the stability of the Cauchy functional equation: a fixed point approach, ” in Iteration ... Academy of Sciences of the United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, ... Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 13 G Isac and Th M Rassias, “Stability of Ψ-additive mappings: applications to nonlinear analysis,” International Journal of Mathematics...
- 10
- 296
- 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... treated the Cy3 and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then ... array, the geometric mean of the measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the values of all ... contributions EG analyzed all the microarray data and printed the arrays NM printed the arrays and participated in some of the expression studies AP performed many of the expression studies and the ChIP-chip...
- 15
- 376
- 0
The Study of Service Quality and How It Influences Student Satisfaction in Phương Đông College.
... customer satisfaction through perceived service quality” Parasuraman, A (1985) A conceptual model of service quality and its implications for future research” Parasuraman, A (1988) “SERVQUAL: A ... to improve it or what they dislike about the services and how to fix the flaws Free Powerpoint Templates Page There are many gaps between customer and service provider Understand these gaps ... have to spend another year to improve their examination score hoping to get in the year after Some apply to the other 400 private universities and colleges Free Powerpoint Templates Page To...
- 36
- 513
- 1
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx
... to the design of the study, in the analysis and interpretation of data, and drafting of the manuscript AD was responsible for the Danish arm of EXACTLE and reviewing/contributing to writing the ... 27709, USA) and was conducted between November 2003 and January 2007 Two of the authors of the manuscript (MW and CD) are employees of Talecris and participated in the design of the study, in the ... the study therapy and had at least valid CT scan measurement at baseline and valid CT scan assessment at Month 12 or thereafter [13] Page of 10 (page number not for citation purposes) Respiratory...
- 10
- 439
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and the samples were incubated ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...
- 13
- 707
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... BLASTP-based protein database searching and functional classification All peptide sequence tags (Table 2) were searched against the dog genome database using BLASTP, version 2.2.16 Database size was ... match-set Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated...
- 20
- 506
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
- 11
- 731
- 0
A further contribution to the study of the mortuary customs of the North American Indians docx
... brought and placed around the feet and legs of the horse, and gradually laid up to its sides, and at last over the back and head of the unsuspecting animal, and last of all over the head and even the ... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... erected, to which the skulls and hair are attached as a trophy The bow, arrows, assagai, and clubs of the deceased are on the same post Large stones are pressed into the soil above and around the grave,...
- 108
- 604
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008