a checklist for historical studies of species responses to climate change
building resilience adaptive strategies for coastal livelihoods most at risk to climate change impacts in central viet nam
... SLF to better elucidate the differing vulnerabilities of social actors to climate hazards allows for better capture of this variability HVCA involves a participatory analysis of past patterns of ... weather-related hazards occur on a regular basis and the impacts of climate change are already being observed To enable better preparedness for climate variability, improved information on seasonal ... undertaking climate change adaptation measures In 2007 it was noted that there was limited government ownership of an adaptive approach to climate changerelated risks, and limited state funding available...
- 172
- 472
- 1
A Checklist for Retrospective Database Studies—Report of the ISPOR Task Force on Retrospective Databases pot
... examples of approaches that can be used to address the quality of a database are to compare data figures to established norms (e.g., rates of asthma diagnosis compared to prevalence figures) and ... not static attributes of a database but can vary dramatically depending on the questions asked and analyses performed Quality checks are particularly important with administrative databases from ... serve as a supplement to already available checklists for economic evaluations [3,4] Only those issues that are unique to database studies or are particularly problematic in database research...
- 8
- 472
- 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc
... Cochard et al, 1992; Bréda et al, 1993) In addition, the ability to maintain significant rates of CO assimilation and to keep a functional pho- to- synthetic apparatus during drought may have an ... Q rubra All species exhibited similar rates of change in A and g ψ decreased Decreases in A w wp as began above -1.0 MPa but were gradual Values close to zero were obtained in all cases when ... and dry weight of the shoot Gas-exchange measurements Stomatal conductance for water vapour (g and ) w net CO assimilation rate (A) were recorded us2 ing a portable gas-exchange measurement system...
- 13
- 402
- 0
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
... comparable to other data sets analysed, multiple data points for a species were replaced by a single data point calculated as the average value of body weight and the average value of BMR for ... conceptualization has also been used to develop a five-compartment anatomical model (brain, liver, kidney, heart and all other organs) as an explanation for Kleiber's law [28] The anatomical con- Page ... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric...
- 8
- 356
- 0
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt
... services for patients of all ages An Asthma Task Force was convened to develop systems approaches to improve the diagnosis and management of asthma within the health centers The Asthma Task Force ... with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and Asthma Action Plan The Asthma Test ... gap in asthma prevalence, morbidity, and mortality among African Americans as compared with Caucasians, the study was designed to identify alternative beliefs and behaviors To identify causal...
- 24
- 522
- 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf
... neuroimaging studies In fact, frontal activity detected by Cela-Conde et al (2004) (dorsolateral), Kawabata and Zeki (2004) (orbitofrontal) and Vartanian and Goel (2004) (anterior cingulate) was associated ... use of artistic vs simple visual materials in experimental aesthetics: “In the former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art ... three studies is the task that participants were asked to perform Kawabata and Zeki (2004) asked their participants to rate the beauty of the stimuli on a 3-point scale (beautiful, neutral, ugly),...
- 19
- 526
- 0
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc
... context-based machine translation evaluation Machine Translation, 17(1):43–75 Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara 2005 Analysis of machine translation ... languages, and stemming for 15 languages The synonym module uses WordNet, and is only available for English The paraphrase module is based on an automatic paraphrase induction method (Bannard and ... among annotations B LAST can handle two types of annotations: error annotations and support annotations Error annotations are based on a hierarchical error typology, and are used to annotate errors...
- 6
- 479
- 0
Báo cáo khoa học: "A System for Semantic Analysis of Chemical Compound Names" pdf
... chemical compound names, name normalization is a possible approach Rules can be set up to transform syntactic as well as morphological variations of names into a normalized name form Basic transformations ... constraints over a collection of variables Each of the variables has a domain, which is the set of possible values the variable can take For the reasons named above, we are working with graph variables ... gold standard for name -to- structure generation or classification is available yet, such a gold standard or dataset needs to be created first We propose to use as such a dataset a subset of the...
- 9
- 479
- 0
Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf
... transform a deep-syntactic representation into a llnearized list of all the lexemes and punctuation marks composing a sentence The format of the declarative lexicon and of the grammar rules is that ... syntactic, surface form) • Rhetorical dictionary: a knowledge base indicating how to realize rhetorical relations linguistically • Conceptual dictionary: a knowledge base used to map language-independent ... exemplar: • Name: Specification of the name of the exemplar • Parameters: Specification of the arguments passed in parameters when the exemplar is called • Conditions of evaluation: Specification of the...
- 5
- 419
- 0
The Temporal Pattern of Mortality Responses to Air Pollution: A Multicity Assessment of Mortality Displacement potx
... Tenias, E Alonso, K Kambra, E Aranguez, A Gandarillas, I Galan, J M Ordonez (Spain); M A Vigotti, G Rossi, E Cadum, G Costa, L Albano, D Mirabelli, P Natale, L Bisanti, A Bellini, M Baccini, A ... APHEA-2 methodology.23 Because of AIR POLLUTION AND MORTALITY DISPLACEMENT 89 the substantial variability in seasonal patterns and weather between, for example, Stockholm and Tel Aviv, separate ... original data were measured as total suspended particulate In these three cities, data were converted to PM10 as a function of both black smoke (total suspended particulate for Budapest) and season,...
- 7
- 424
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... evaluating with that test-bed is reliable (JACK measure) Formal constraints on any evaluation framework based on similarity metrics We are looking for a framework to evaluate automatic summarisation systems ... quality of an automatic summary a ∈ A, given a set of models M and a similarity metric x An obvious first attempt would be to compute the average similarity of a to all model summaries in M in a test ... editors, HLT-NAACL 2003 Workshop: Text Summarization (DUC03), Edmonton, Alberta, Canada, May 31 - June Association for Computational Linguistics C Lin 2004 Orange: a Method for Evaluating Automatic...
- 10
- 517
- 0
Báo cáo khoa học: "A Model for Robust Processing of Spontaneous Speech by Integrating Viable Fragments*" ppt
... the parser has to simultaneously perform two tasks: Searching for a path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ungrammatical ... semantic predicates, a list of scopal constraints, syntactic, prosodic and pragmatic information as well as tense and aspect and sortal information An example of a VIT for the sentence Montag ... task of the robust semantic processing is to manage a possibly large number of partial analyses, each spanning a certain sub-interval of the input utterance The basic mode of processing - - store...
- 5
- 426
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... number of transcriptional factors that are key regulators of HSC development For instance, the stem cell leukemia factor Scl, has been shown to play a pivotal role in endothelial and hematopoietic ... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... of diseases before clinical medical application can become a reality Ontogeny of human hematopoiesis Hematopoietic ontogeny has been the subject of intensive investigation by several groups As...
- 12
- 550
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC...
- 11
- 679
- 0
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot
... It is clear that a program can rank Candidate higher than Candidate simply by comparing ngram matches between each candidate translation and the reference translations Experiments over large collections ... of translations presented in Section show that this ranking ability is a general phenomenon, and not an artifact of a few toy examples The primary programming task for a BLEU implementor is to ... humans can clearly distinguish a good translation from a bad one For example, consider these two candidate translations of a Chinese source sentence: Example Candidate 1: It is a guide to action...
- 8
- 336
- 0
Báo cáo khoa học: "Towards a Framework for Abstractive Summarization of Multimodal Documents" pot
... standard” to compare our output against Discussion The work proposed herein aims to advance the stateof-the-art in automatic summarization by offering a means of generating abstractive summaries ... EmployedAt1 Person1 AmountPerShare3 StockPriceChange1 Market2 EmployedAt1 StockPriceChange2 MakeAnnouncement1 AmountPerShare1 Company2 TargetStockPrice1 Idiom1 AmountPerShare2 Comparison3 StockRating1 ... focus to a limited class of images for the prototype implementation Information graphics, such as bar charts and line graphs, are commonly found in popular media (e.g., magazines, newspapers) accompanying...
- 6
- 370
- 0
Báo cáo khoa học: "a System for Cross-fertilization of Computational Lexicons" pdf
... Marinelli, and Antonio Zampolli 2003 ItalWordNet: Building a Large Semantic Database for the Automatic Treatment of Italian In Antonio Zampolli, Nicoletta Calzolari, and Laura Cignoni, editors, Computational ... resorting to an automatic application that acquires information about semantic relations from corpora, the acquired relations are integrated into the entry and proposed to the human encoder In order to ... as an SVG (Scalable Vector Graphics) image Figure illustrates the overall implementation of the system 5.1 References Nicoletta Calzolari, Francesca Bertagna, Alessandro Lenci and Monica Monachini,...
- 4
- 416
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25