1 25 dihydroxyvitamin d3 and its analogs
Báo cáo y học: "1, 25-dihydroxyvitamin D3 decreases adriamycin-induced podocyte apoptosis and loss"
... permeability http://www.medsci.org Int J Med Sci 2 010 , 7 10 11 12 13 14 15 16 17 18 19 20 21 22 and is inhibited by Bcl-2 J Biol Chem 2006; 2 81( 21) : 14 764 -14 775 Makibayashi K, Tatematsu M, Hirata M, ... control group, 1. 04±0.22, 0.79±0 .12 , 0.52±0 .13 , 0.44±0 .11 , 0. 61 0 .12 , and 0.23 ± 0.07, respectively, in the ADR group, and 0.83±0. 21, 0.95±0 .17 , 0. 31 0.09, 0.35±0 .10 , 0.34±0 .10 , and 0. 61 0 .13 , respectively, ... version 11 .0 Group control ADR ADR +1, 25( OH) 2D3 n 16 15 16 Podocytes 5.46±0. 51 3.35±0 .14 ## 4.44±0.23## △△ Data are means ± SD FPW, foot process width FPW (nm) 2 71. 38±52.48 806 .13 12 0 .19 ## 4 01. 13±52.48##...
- 10
- 463
- 0
Báo cáo khoa học: "Calcium metabolism in cows receiving an intramuscular injection of 1,25-dihydroxyvitamin D3 combined with prostaglandin F2?? closely before parturition" doc
... 9.4 1. 0 10 .7±0.80 9.4±0.6 11 .0±0.9* 8.3 1. 2 10 .8 1. 0* 8.6±0.9 11 .5 1. 0* 8.3 1. 00 8.5±0.8 9 .1 0.6 10 .0 1. 10 11 .1 1. 1** 11 .1 0.9* 10 .3±0.7* 9.6±0.5 3.3±2.0 5.8 1. 2 3.5 1. 40 6.3 1. 5* 2.5 1. 5 06.0 1. 9* ... 2.4±0.2 -1 -0.5 0.5 53.6±22 .1 52.9 14 .300 73.3±35.300 75.4±23.80 11 85.0±384 .1* 694.5±526.7** 596.6±338.4** 3 91. 4 18 8.9* 96.6 25. 9 95.8± 31. 7 95.4±23.0 57.4 16 .20 51. 9±59 .1 65.2 17 .5 45.9 11 .6 20.2 12 .5* ... Prepartum 1, 25( OH) D (pg/ml) Control 36.8±9.80 1, 25( OH) D 28.7 13 .4 Ca (mg/dl) Control 9.7±0.3 1, 25( OH) D 9.8±0.6 iP (mg/dl) Control 5.0±0.5 1, 25( OH) D 4.5±0.9 Mg (mg/dl) Control 2.3±0.2 1, 25( OH)...
- 3
- 223
- 1
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... 13 1.75 15 .50 Blood glucose (mg/dl) 0.5h 1h 12 7.63 12 .68 10 4.75±20.55 Diabetic control group 300.63 10 4.69a 244 .13 10 7.03b 222.75 10 4. 81 b 2 01. 38± 91. 64 b 209.50±87. 61 a 203.75 10 0.30 a 18 0 .25 11 1.82 ... China (No: 306 710 07, 3030 016 5) and the grant from the Traditional Chinese Medicine Administration of Zhejiang Province, China (No: 2 010 ZB075) 209 10 11 12 13 14 15 16 17 Chen J, Bai G, Cao Y, et ... 18 0 .25 11 1.82 b Diabetic treated group 294 .13 ±89.97a 208 .13 ±76.43 17 0.00±76. 91 1.5h 98.38±24.44 15 0 .13 ±56.23 2h 93.88±30.70 13 0.63±47.67c 2.5h 76.75±33. 01 92.63±46 .12 d 3h 75.38±34.99 87.88±46.76 c a...
- 7
- 612
- 0
Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf
... Caspase 1. 529 0.537 0.859 0.657 0.303 0.268 0.233 0 .14 9 0 .11 3 0.068 0.064 0.055 0.053 0.040 0.474 0 .13 7 0.2 01 0 .14 8 0.079 0.079 0. 216 0.386 0. 218 0 .13 6 0 .11 3 0 .15 1 0.057 0.063 1. 913 0.835 1. 122 2.360 ... 0.835 1. 122 2.360 0.684 0.987 0. 425 1. 574 1. 300 1. 640 1. 811 0.933 2 .10 4 0.860 ± ± ± ± ± ± ± 0.2 41 0.035 0.073 0.086 0.0 51 0.032 0.027 ± ± ± ± ± ± ± 0. 015 0. 011 0.006 0.004 0.004 0.002 0.003 However, ... 0.0 31 0.027 0. 017 0. 014 ± ± ± ± ± ± ± 0.034 0.024 0. 014 0. 016 0.009 0.007 0.007 ± ± ± ± ± ± ± 0 .15 2 0. 016 0.043 0 .15 5 0.023 0. 025 0.055 ± ± ± ± ± ± ± 0.284 0 .12 7 0.089 0. 315 0 .15 2 0.708 0 .15 5...
- 11
- 388
- 0
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx
... protein in a highly pure form, and to Michel Léonetti (CEA, Saclay, France) for the monoclonal anti-Tat 7S and 11 S antibodies References 10 11 12 13 14 15 16 17 18 19 20 21 Strebel K: Virus-host interactions: ... TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 reverse for Tat1:← 17 18 and for Tat2:← 17 70) (11 1)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG 3' (exon1:reverse:← 11 1) UTRTatNcoI rev 5' TATATTACCATGGTTCTTGCTCTCCTCTGTCGAGTAACG ... 200000 10 0000 Tat-HeLa (ng/1L) RNA : 10 0 300 Rluc 10 0 300 UTR2Tat1-Rluc C 10 0 300 UTR2Tat2-Rluc TAR-polyA-Rluc RNA 30000 Renilla activity 250 00 20000 15 000 10 000 5000 Tat-HeLa (ng/1L) 10 0 300...
- 18
- 240
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 1
... 1. 1.4 Subtypes of PPARs 1. 1.5 Ligands and physiological functions of PPARα and PPARδ 1. 1.6 Ligands of PPARγ 1. 1.7 PPARγ and adipogenesis 10 1. 1.8 PPARγ and ... 12 1. 1.9 PPARs and cancer 13 1. 1 .10 PPARγ and breast cancer 15 1. 2 ESTROGEN RECEPTORS (ERS) 18 1. 2 .1 Identification and structures of ERs 18 1. 2.2 Mechanism ... 34 1. 3.5 NHE1 and cell migration 35 1. 3.6 NHE1 and heart disease 35 1. 3.7 NHE1 and cancer 36 1. 3.8 Regulation of NHE1 activity 39 1. 3.9 Regulation of NHE1...
- 89
- 368
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 2
... in NHE1 mRNA by NAC (Figure 11 C), further confirming that ROS/RNS 10 5 contributes approximately 20% of the overall down-regulation of NHE1 transcription by 5M of 15 d-PGJ2 10 6 Figure 11 : ROS/RNS ... PPARγ ligands: (A) 15 d-PGJ2, (B) troglitazone for 24h, and the protein expression of NHE1 was analyzed by Western blot (C) MDA-MB-2 31 (2X105 cells/6-well dishes), and T47D cells (3 X105 cells/6-well ... X 10 6 /10 0mm dish) and (B) MDA-MB-2 31 (1. 7 X 10 6 cells /10 0mm dish) cells were exposed to 3M 15 d-PGJ2 for 4h before harvesting for nuclear-cytosol fractionation as described in Materials and Methods...
- 42
- 295
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 4
... alpha 13 1 Figure 19 : Re-expression of ERα blocks PPARγ-mediated down-regulation of NHE1 expression in MDA-MB-2 31 cells (A) MDA-MB-2 31 (2X105 cells/6-well dishes), and (B) MDA-MB-2 31 ERα+ (2X10 cells/6-well ... (2X10 cells/6-well dishes) and MDA-MB-2 31 ERα+ (2X105 cells/6-well dishes) cells were treated with 15 d-PGJ2 for 16 h with or without 2h pre-incubation of 1 M E2, and the fold change of NHE1 mRNA ... with 15 d-PGJ2 for 24h with or without 2h pre-incubation of 1 M E2, and the protein expression of NHE1 was 13 2 analyzed by Western blot NHE1 band intensity was normalized to β-actin (C) MDA-MB-231...
- 21
- 176
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 6
... Diabetologia 51( 11) : 210 8 211 6 Jurka, J and A Milosavljevic (19 91) "Reconstruction and analysis of human Alu genes." J Mol Evol 32(2): 10 5 -12 1 Kallinowski, F., P Vaupel, et al (19 88) "Glucose ... Symp Proc (1) : 14 9 -16 1 Hartman, J., K Lindberg, et al (2006) "Estrogen receptor beta inhibits angiogenesis and growth of T47D breast cancer xenografts." Cancer Res 66(23): 11 207 -11 213 Hauser, ... 14 64 -14 76 Badawi, A F and M Z Badr (2003) "Expression of cyclooxygenase-2 and peroxisome proliferator-activated receptor-gamma and levels of prostaglandin E2 and 15 deoxy-delta12 ,14 -prostaglandin...
- 62
- 322
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 3
... MDA-MB-2 31 (2 X 10 5 cells/6-well dishes) and T47D (3 X105 cells/6-well dishes) cells were treated with 15 d-PGJ2, for 16 h before they were washed and reseeded at a density of 1. 0 X 10 4 cells /10 0mm ... MCF-7 (3 X10 cells/6-well dishes) cells were exposed to (A) 15 d-PGJ2 and (B) ciglitazone for 16 h before they were washed and reseeded at a density of 1. 0 X104 cells /10 0mm dish After 14 days of ... of 15 d-PGJ2 treatment for 16 h before the colony forming assay was performed as described in Materials and Methods Similar to what we observed in MCF-7, 15 d-PGJ2 resulted in a dose-dependent 11 1...
- 6
- 142
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 5
... regular serum were given 10 nM fulvestrant or 10 0nM raloxifene for 2h before the introduction of 15 d-PGJ2 The cells were trypsinized and reseeded onto 10 0mm dish after 18 h, and a 14 -day colony forming ... with 15 d-PGJ2 for 48h with or without 2h pre-incubation of 10 nM Fulvestrant in medium containing 10 % regular serum, and the protein expressions of NHE1 was analyzed by Western blot NHE1 band intensity ... (C) MDA-MB-2 31 ERα+ (1. 5 X10 cells/6-well dishes) cells were treated with 15 d-PGJ2 for 40h with or without 2h pre-incubation of 10 nM Fulvestrant in media containing 10 % regular serum, and the fold...
- 32
- 253
- 0
Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2
... transport and catabolism 1ppv, 1p0n, 1x84, 1x83, 1vcf, 2zru Nucleotide transport and metabolism 1tls, 1ju6, 1qzf, 3k2h, 3jsu, 3cl9, 2aaz, 2blc, 1j3j, 1tvv, 1hvy, 3nrr, 1tlc, 1f28, 1sej, 1tsd, 1o26, ... transport and metabolism 1o27, 1tsd, 1sej, 1tuv, 1tls, 1o25, 1b02, 1qzf, 3jsu, 3k2h, 2aaz, 2blc, 1j3j, 3clb, 1hvy, 1tlc 3. 21 0.3 71 15 Androgen receptor Steroid hormone receptors are ligandactivated ... 15 1 Hypothetical protein - 1vhn, 2q6i, 3kyf, 3kyg, 1ofu, 2e87, 2yqz, 2hek, 2ogi, 1yre, 2d1y, 1p0h, 1q6y, 2gf6 3.358 0.2799 3 .19 7 0.2906 1emd, 3i0p, 1emd, 1hex, 1o6z, 1ur5, 3gvh, 1b8v, 1bmd, 1z2i,...
- 55
- 349
- 0
Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1
... MDA-MB-2 31 152a C6H5 11 .0±3.6 9.0±3.7 15 2b 4-MeC6H4 16 .0±0 .1 6.0 1. 0 15 2c 4-MeOC6H4 19 .0±0 .1 5.0±2.4 15 2d 4-FC6H4 8.0±0.3 7.0±0.9 15 2e 4-BrC6H4 2.0±0.5 14 .7 1. 3 15 2f 4-CF3C6H4 2.0 1. 9 15 .0 1. 7 15 2g ... (49.9) 14 9g 2-Thienyl$ >62.5 >62.5 14 9h 2-Pyr >10 0 (14 .9) >10 0 (5.0) 14 9i 4-CH2CH2Ph >10 0 (40.5) >10 0 (10 .4) 14 9j 4-cyclohexyl >10 0 (34.4) >10 0 (11 .8) 14 9k Isopropyl >10 0 (14 .5) >10 0 (2.8) 14 9l ... MDA-MB2 31 151a C6H5 3.6±0.5 Not active 15 1b 4-MeC6H4 18 .8±0.2 Not active 15 1c 4-MeOC6H4 11 .9±0.7 Not active 15 1d 4-ClC6H4 2.7±0.4 Not active 15 1e 4-CF3C6H4 2.5±0.2 Not active 15 1f 4-CNC6H4 1. 9±0.5...
- 143
- 416
- 0
Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"
... 6 31 ± 48 Shamoperation + 1, 25 vit-D 5 51 ± 53 CLP +vehicle CLP + 1, 25 vit-D 647 ± 95 Control + 1, 25 vit-D 606 ± 13 9 418 ± 49 b 515 ± 53 c 12 ,0 ± 0,2 12 ,2 ± 0,7 11 ,4 ± 0,6 11 ,0 ± 0,8 12 ,5 ± 1, 2 12 ,7 ... 19 8 a LPS +1, 25 vit-D 208 ± 214 a 12 ,0 ± 0,2 12 ,2 ± 0,7 11 ,4 ± 0,4 a 12 ,0 ± 0,4 53 ± 53 ± 12 4 ± 16 7 94 ± 24 a 0,68 ± 0,29 0,62 ± 0,27 1, 77 ± 1, 10 2 ,12 ± 0,53 a 41 ± 46 ± 19 44 ± 57 ± 11 8,2 ± 0,5 ... (mmol/L) 19 3 1, 27 ± 0,35 1, 27 ± 0 ,13 2,66 ± 0,65 a 3,26 ± 0,60 a 55 ± 62 ± b 76 ± a 10 3 ± 19 a,b 6,3 ± 1, 1 7,8 ± 0,7 11 ,8 ± 0,8 a 13 ,3 ± 1, 0 a,b 1, 34 ± 0,02 1, 42 ± 0,05 b 1, 24 ± 0,04 a 1, 28 ± 0,04...
- 6
- 505
- 1
Tài liệu Báo cáo khoa học: Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters docx
... 57.95 86. 01 46. 21 50 1. 29 55 569 7.0 (40.2) 15 .2 (2.3) 93.9 (70.4) 10 1. 29 15 .5 19 .3 17 7 (14 3.6) 58 .12 85. 91 46 .10 50 1. 16 73 638 7.2 (35.7) 20 .1 (2 .1) 91. 8 (58.9) 10 1. 16 15 .4 18 .8 242 (2 21. 5) 57.50 ... 58 .11 85.97 46.42 50 1. 02 11 3 227 5.7 (38.2) 15 .3 (2.6) 95.8 (65.0) 10 1. 02 12 .4 14 .2 292 (207.3) 57.77 86 .13 46.28 50 1. 20 66 626 8 .1 (44.2) 11 .3 (2.5) 91. 6 (62.7) 10 1. 20 16 .4 20 .1 1 51 (12 9.8) ... (min )1) kcat ⁄ Km (lMÆmin )1) Relative kcat ⁄ Km Ki (nM) 30 65 10 9 41 43 73 13 19 0 12 0 68 300 13 0 320 950 6.5 1. 8 0.6 7.3 3 .1 4.4 73 1. 0 0.3 0 .1 1 .1 0.5 0.7 11 .2 0 .15 1. 5 4.5 0.50 0. 41 0.9 0 .16 ...
- 16
- 582
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... variant PAI -1 variant Activity (%) t½ (min) Wild-type T96A F100A V126A F128A S129A E130A V131A E132A R133A R135A F136A I137A I138A N139A D140A W141A V142A K143A T144A H145A T146A K147A M149A N152A E283A ... G155K, D (15 6 15 7), A158E M149K, G155K, D (15 6 15 7), A158E N152D, G155K, D (15 6 15 7), A158E M149K, N152D, G155K, D (15 6 15 7), A158E 74 83 99 75 83 66 58 62 93 63 13 6 67 50 67 73 15 6 76 14 8 * Significantly ... indistinguishable results: wild-type, PAI -1( T96A), PAI1(F100A), PAI -1( V126A), PAI -1( F128A), PAI -1( I137A), PAI -1( I138A), PAI -1( N139A), PAI -1( W141A), PAI1(T146A) and PAI -1( M149K) Structural analysis Structural...
- 9
- 605
- 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... 2, pUC19 and 10 mM DTT; lane 3, pUC19 and lM FeCl3; lane 4, pUC19, 10 mM DTT, and lM FeCl3; lane 5, pUC19, 10 mM DTT, lM FeCl3, and 50 lgÆmL )1 rBcp2; lane 6, pUC19, 10 mM DTT, lM FeCl3, and 50 ... thioredoxin reductase and thioredoxin) (Fig 1) Two archaeal Prxs from Aeropyrum pernix APE2278 [10 ] and Pyrococcus horikoshii PH1 217 [11 ,12 ] have A H2O 1- Cys Prx 1- Cys Prx H2O2 Sp OH 722 Identification ... solfataricus P2 [14 ] (http://www-archbac.u-psud.fr/ projects/sulfolobus/) revealed four ORFs homologues of Prxs and annotated as Bcp1 (SSO20 71) , Bcp2 (SSO 212 1), Bcp3 (SSO 225) and Bcp4 (SSO2 613 ) The S...
- 11
- 565
- 0
Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc
... two subunits in calpains [18 ] Indeed, the two subunits of 80 kDa (domains I–IV) and 30 kDa (domains V–VI), contain altogether 10 11 putative EF-hands motifs in domains IV, VI and II [1, 19,20], ... calcium (Figs 2A and 5B, 10 min) as in its presence (not shown) Furthermore, the 76, 50 and 30 kDa fragments issued from the 12 0 autolysis of Calp1, and recognized by anti-Calp1 (Fig 5Ba, 12 0 min), ... (19 97) Calpains: intact and active? Bioessays 19 , 10 11 10 18 Rutledge, T.W & Whiteheart, S.W (2002) SNAP-23 is a target for calpain cleavage in activated platelets J Biol Chem 277, 37009–37 015 ...
- 9
- 334
- 0
Báo cáo khoa học: Anti-HIV-1 activity of 3-deaza-adenosine analogs Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners pot
... HIV -1 in vitro J Infect Dis 16 6, 11 43 11 46 38 Larder, B.A., Darby, G & Richman, D.D (19 89) HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy Science 243, 17 31 17 34 ... alkyl functional group and alkane molecules J Am Chem Soc 11 6, 2 515 252 5 31 Maple, J.R., Hwang, M.-J., Stockfisch, T.P., Dinur, U., Waldman, M., Ewig, C.S & Hagler, A.T (19 94) Derivation of class ... Biochem Biophys Res Commun 11 4, 505– 510 51 Helland, S & Ueland, P.M (19 81) Interaction of 9-b-D-arabinofuranosyladenine, 9-b-D- arabinofuranosyladenine 5¢-monophosphate, and 9-b-D-arabinofuranosyladenine...
- 11
- 303
- 0
Appendix 1 To Chapter The Savings and Loan Crisis and Its Aftermath potx
... accident: the combination of sharp increases in interest rates from late 19 79 until 19 81 and a severe recession in 19 81 19 82, both of which were engineered by the Federal Reserve to bring down ... Losses for savings and loan institutions mounted to $10 billion in 19 81 19 82, and by some estimates more than half of the S&Ls in the United States had a negative net worth and were thus insolvent ... legislation in 19 80 and 19 82 that made it easier for savings and loans to engage FYI The Principal-Agent Problem in Action: Charles Keating and the Lincoln Savings and Loan Scandal As we have...
- 8
- 371
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25