Characterization and function studies of ncr1p a yeast ortholog of mammalian niemann pick c1 protein (NPC1)
Characterization and function studies of ncr1p a yeast ortholog of mammalian niemann pick c1 protein (NPC1)
... Abbreviations and Symbols Used ABCG ATP-binding cassette protein G gene subfamily ACAT acyl-CoA: cholesterol acyltransferase ALP alkaline phosphatase AMPK AMP-activated protein kinase APOE4 apolipoprotein ... 35 - associates with ER membranes by interacting with VAMP associated protein (VAP, VAP -A and VAP-B) (Wyles et al., 2002) Both VAP -A and VAP-B (INSIG1 and 2) associate with SCAP, which interacts ... CoA Acetyl CoA CoA-SH CoA-SH Acetyl CoA Acetoacetyl CoA Hydroxymethylglutaryl CoA NADPH+2 H+ NADP++CoA-SH ATP ATP ADP ADP 5-Pyrophosphomevalonate 5-Phosphomevalonate Mevalonate ATP ADP+Pi+CO2 Isopentenyl...
- 205
- 351
- 0
Preparation, characterization and property studies of carbon nanostructures derived from carbon rich materials
... Thesis Title: PREPARATION, CHARACTERIZATION AND PROPERTY STUDIES OF CARBON NANOSTRUCTURES DERIVED FROM CARBON RICH MATERIALS Abstract Carbon nanomaterials have always been an area of interest for ... amorphous carbon Physical and chemical properties of carbon vary in each of the allotropes For example, diamond is one of the hardest materials existing in nature and graphite is as the soft materials ... preparation, characterization, properties, reactions and applications of carbon nanomaterials, in particular, graphite and graphene 1.1 Carbon Nanomaterials Fullerenes, carbon nanotubes (CNTs), carbon...
- 210
- 266
- 0
Characterization and immunological studies of fish nervous necrosis virus
... CHARACTERIZATION AND IMMUNOLOGICAL STUDIES OF FISH NERVOUS NECROSIS VIRUS BY ASHOK HEGDE (MFSc) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... viral nervous necrosis virus (VNN) of larval and juvenile fish I.3 21 Geographical and species distribution of clinical nervous necrosis virus (VNN) 22 2.1A Primers used for amplification of RNA1 ... 2001) of immunization of fish against nervous necrosis virus Therefore, the present study was aimed at detailed characterization and pathogenicity studies of NNV, and to test the efficacy of recombinant...
- 179
- 402
- 0
High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica
... nm, and (e) 7.1 nm 3.2 Synthesis and Characterization of Pt /SBA-15 Catalysts 3.2.1 Incorporation of the Pt Particles in SBA-15 Structure SBA-15 with a pore diameter of 9.0 nm was used as a catalyst ... the conditions of catalyst synthesis The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no significant blocking of the SBA-15 channel ... methods according to the literature.9,10 Methanol, ethanol, and ethylene glycol served as solvents for dissolving Pt salts and PVP, and as a reducing agent of Pt according to the following reaction: ...
- 11
- 471
- 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... The histamine releases were measured by an enzyme immunoassay (Immunotech) After subtraction of the spontaneous release of the basophils, the allergeninduced histamine release was calculated as ... self-prepared tomato extract, nLyc e 2, rLyc e 2, horseradish peroxidase, deglycosylated horseradish peroxidase, the glycopeptide MUXF and MUXF conjugated to BSA as well as BSA alone were used ... SDS/PAGE analysis of electroeluted recombinant Lyc e isoforms rLyc e 2. 01 (lane 1) and rLyc e 2. 02 (lane 2) , Coomassie stain M, molecular mass marker reacted with the recombinant protein in the ELISA,...
- 11
- 533
- 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact ... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original spectra ... immunodeterminant of M fermentans, as anti-(MfGl-II) sera not cross-react with lipid extracts of other Mycoplasma species like Mycoplasia penetrans [8] The comprehensive characterization of MfGl-II from pathogenic...
- 9
- 665
- 1
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively The PCR ... 31 Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A. , Borkowski, J., Ihara, M & Ohta, M (1998) Cloning and characterization of a new subtype of thyrotropin-releasing hormone receptors...
- 11
- 506
- 0
Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx
... inactivation of c-aminobutyric acid transaminase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and ... various AdoMet and KAPA concentrations n 20 lM KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA (B) Replot of the ordinate intercepts against KAPA concentrations Data were tted to straight ... His6-tagged bioA gene, the primers were the following: 5ÂCGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3Â containing an EcoRI restriction site, a ribosome-binding site and a His6 tag coding...
- 12
- 490
- 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
... examined in T ni [26] JHEH activity was very low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium At ... biotransformation, we first examined induction of EH activity by several chemicals in the larvae of a standard D melanogaster strain, Canton-S We found that exogenous chemicals altered EH activity and that ... P...
- 10
- 378
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are...
- 8
- 465
- 0
Báo cáo Y học: Unfolding and refolding studies of frutalin, a tetrameric D-galactose binding lectin doc
... spectra for Th and Ch of the Nfrutalin, Ufrutalin, Rfrutalin and Mfrutalin forms Nfrutalin had a minimum at 218 nm and a maximum at 203 nm Ufrutalin had the typical spectrum of the proteins that have ... integrifolia: amino acid sequence, predicted tertiary structure, carbohydrate recognition, and analysis of the beta-prism fold Protein Sci 8, 13–24 Sankaranarayanan, R., Sekar, K., Banerjee, R., Sharma, ... constraint analysis [19,20] as described in Materials and methods, and showed 86% of beta components (antiparallel and parallel b sheet, and b turns) and 16% of other contributions for both the native...
- 6
- 403
- 0
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx
... McsB of Bacillus anthracis A R Mattoo et al and Gram-negative bacteria Exopolysaccharides play an important roles in bacterial virulence, suggesting a role for tyrosine kinases in bacterial pathogenesis ... orthologs of SalA (BAS0147 and BAS3357, showing similarities of 85% and 65%, respectively), MinD (BAS4346, showing a similarity of 90%) and SojA (BAS5333 and BAB82448, showing similarities of 92% and ... to define an ortholog [18,19] A blast search using the PtkA and PtkB protein sequences against the B anthracis database revealed that the orthologs of these kinases are absent in B anthracis Interestingly,...
- 11
- 407
- 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... between archaea and bacteria from genome sequence of Thermotoga maritima Nature 399, 323–329 Lim D & Strynadka A (2002) Structural basis for the b-lactam resistance of PBP 2a from methicillin-resistant ... triad, consisting of a serine in a New thermostable esterase from Thermotoga maritima GXSXG pentapeptide, an acidic aspartate, and a histidine residue The structural modeling was expected to be ... typical structural features of this type of enzyme Bacterial esterases and lipases have been classified into eight families based on a comparison of their amino acid sequences and some fundamental...
- 11
- 460
- 0
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
... kDa, a second peak of 30 kDa and a third peak of about 20 kDa A similar gel filtration experiment was also carried out for the complex of XAIP with a- amylase A mixture of XAIP and a- amylase was ... observations indicate that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution of XAIP The output of SDS–PAGE for ... that XAIP inhibits the activity of a- amylase in a : 1.2 molar ratio The inhibition of a- amylase by XAIP was also observed in the presence of GH11 xylanase Thus, the inhibition of a- amylase by XAIP...
- 15
- 399
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)