Proteomics analysis of pseudomonas putida in biodegradation of aromatic compounds

... PROTEOMICS ANALYSIS OF PSEUDOMONAS PUTIDA IN BIODEGRADATION OF AROMATIC COMPOUNDS CAO BIN (B Eng., Beijing University of Aeronautics and Astronautics, China) A THESIS SUBMITTED ... understanding of the catabolic pathways and the physiological status of P putida during biodegradation of aromatic compounds A comprehensive understanding of the bacterial physiology during biodegradation ... tool to kinetics analysis of biodegradation systems By applying proteomics methods to biodegradation, a more comprehensive understanding of the biodegradation systems can be obtained Proteomics...

Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

... the C-terminal domain, the E coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expression of the maximum catalytic activity, and in allosteric regulation ... Results Expression and puriﬁcation of E coli Pta and truncated Ptas containing the C-terminal end By analysis of the protein domain architecture of E coli Pta, three conserved domains can be detected ... of this enzyme and also the function of the DRTGG domain Taking into account the important role of Ptas, the results obtained in the present work, dissecting the different domains forming E coli...

Báo cáo khoa học: Antibody-based proteomics Analysis of signaling networks using reverse protein arrays pdf

... Analysis of signaling networks using protein arrays H Voshol et al a contextual understanding of the molecular mechanisms of disease, but also has the potential to facilitate the validation of ... possible Arguably, signaling pathways are currently the best practical translation of ‘physiology’ because Analysis of signaling networks using protein arrays they allow a sufﬁcient level of granularity ... 6877 Analysis of signaling networks using protein arrays H Voshol et al sues within a group of eight different C57 ⁄ Bl6 mice A second step would involve the measurement of the activity levels of...

Báo cáo lâm nghiệp: "Analysis of lipophilic compounds in needles of Pinus pinea L" docx

... methyl esters The main Lipophilic compounds in Pinus pinea L 453 Table III Fatty and resin acids, such as methyl esters, in needles of Pinus pinea (% methylated fatty and resin acid fractions, ... since their values only vary between Lipophilic compounds in Pinus pinea L 451 Table I Presence of monoterpene, sesquiterpene, neutral diterpene, fatty acids and resin acids in needles of Pinus ... [7] in oleoresin of P pinea; the last seven acids in wood and bark by Hafizoglu (1989) [5], and the first six, in soil of a P pinea forest and in plant material from this Pinus species [1] All of...

Proteomics analysis of pro inflammatory cytokine stimulated human lung fibroblasts and bronchial epithelial cells

... global protein profilings of normal human bronchial epithelial cells (NHBE) and normal human lung fibroblasts (NHLF) stimulated with pro- inflammatory cytokines tumor necrosis factor (TNF)-α and/ or ... contribution of two major airway resident cells, bronchial epithelial cells and lung fibroblasts, to the inflammatory events will be reviewed and discussed 1.2.1 Bronchial Epithelial Cells Upon pro- inflammatory ... IFN-γ and TNF-α 23 Mass spectrometry technology for proteomics 35 Scheme of proteomics workflow and intruments 50 Differential protein profiling of TNF-α -stimulated NHLF 69 MS spectrum and Mascot...

Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc

... the pyranopterin part of the cofactor is somehow defective in Qor from strain KT2440 pUF1 UV/Visual spectra of the Qor proteins from P putida 86, P putida KT2440 pUF1 and P putida 86-1 Dqor pUF1 ... putida 86-1 Dqor pUF1 is not able to grow on quinoline as a sole source of carbon Kinetic properties of the Qor proteins from P putida 86, P putida KT2440 pUF1 and P putida 86-1 Dqor pUF1 The apparent ... average of three experiments; c [1] Metal content of the Qor proteins and analysis of nucleotides released from the Qor proteins from P putida 86, P putida KT2440 pUF1 and P putida 86-1 Dqor pUF1...

Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compound analysis potx

... showing significant higher in vivo concentrations in most strains of P aeruginosa [18] This biomarker could then be used in the detection of P aeruginosa in breath, whether or not in combination ... doi:10.1186/1465-9921-13-87 Cite this article as: Goeminne et al.: Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compound analysis Respiratory Research 2012 13:87 Submit ... relation of the samples to a given parameter, particularly P aeruginosa Our findings of terpenes and terpenoids in sputum headspace are interesting as they are common constituents of food Alpha-pinene...

báo cáo khoa học: " The elicitation of a systemic resistance by Pseudomonas putida BTP1 in tomato involves the stimulation of two lipoxygenase isoforms" potx

... 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - primer ... (CATGCCATGGGTGCTGTAGT TACAGTAAGGAAC) and primer (CCGCTCG AGTATCGATACACTATTTGGAAC) - primer (CA TGCCATGGGTCACCACCACCACCACATGGCACT TGCTAAAGAAATTATG) and primer (CCGCTCGAG Page 12 of 15 TTATATCGATACACTATTTGGAAC) ... according to the plant species and pre-inoculated rhizobacterial strain As in the case of P putida BTP1, the resistance induced by B cereus B101R in tomato is not characterized by stimulation of PAL...

Báo cáo y học: "Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis" pps

... cytoskeleton system proteins, which have the maximum profusion among the identified cellular proteins, including Actin, Keratin, Annexin, Coronin, Tubulin, Tropomyosin, and Cofilin Enveloped viruses ... Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis Virology Journal 2010 7:242 Submit your next manuscript to BioMed Central and take ... Localization of actin in Moloney murine leukemia virus by immunoelectron microscopy Virology 1999, 260:23-34 39 Sasaki H, Nakamura M, Ohno T, Matsuda Y, Yuda Y, Nonomura Y: Myosinactin interaction plays...

báo cáo khoa học: " Functional analysis of Arabidopsis WRKY25 transcription factor in plant defense against Pseudomonas syringae" potx

... factors Several classes of transcription factors have been implicated in plant defense responses, including DNA-binding proteins containing the novel WRKY zinc-finger motif [6] Although originally ... underlined C EMSA to test binding of recombinant WRKY25 to the W box motif in the Pchn5 probe Binding reactions containing WRKY25 and Pchn5 produced two major DNA/protein complexes, which are indicated ... mutants for WRKY25 wrky25-1 (Salk_136966) contains a T-DNA insertion in the promoter region while wrky25- 2 (Sail 754_A03) contains a T-DNA insertion in the last intron of the WRKY25 Page of 13 (page...

Multi strategies for control of motility via mora signaling pathway in pseudomonas putida

... ! ! MULTI& STRATEGIES, FOR, CONTROL, OF, MOTILITY, VIA, MORA, SIGNALING, PATHWAY, IN, PSEUDOMONAS, PUTIDA, , , , , , , , , NG WEI LING (B Sc.(Hons), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... messenger signaling Genomic and signaling studies on new models led to the finding that signaling proteins are typically modular in nature with each conserved domain performing a distinct biochemical ... knockout strains of various genes of interest namely: morC, cyaA and opuAC were also created for further studies To understand the role of CyaA and OpuAC in MorA signaling pathway controlling motility...

Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"

... pressure, and heart rate Conclusions Velocity Vector imaging (VVI) is a clinically feasible approach for strain measurements in infarcted myocardium allowing an accurate assessment of global and regional ... Duan Y, Yuan L, Yang Y Velocity vector imaging in assessing the regional systolic function of patients with post myocardial infarction Echocardiography 2007; 24(9): 940-945 15 Jurcut R, Pappas ... boundary during acute myocardial ischemia Am J Physiol 1994; 267(6 Pt 2): 2348-2362 29 Masuda K Assessment of Dyssynchronous Wall Motion During Acute Myocardial Ischemia Using Velocity Vector Imaging...

Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

... molecules in the course of hypoxia-induced apoptotic pathways Such analysis of trophoblastic cells will, in the near future, yield insights into the mechanisms of preeclampsia and other hypoxia-related ... and by modulating phosphorylation of JNK In conclusion, various pro- and antiapoptosis-related proteins were expressed in the process of hypoxia-induced apoptosis in the trophoblastic cell line ... gene, but by modulating phosphorylation of JNKs Thus, Bag-1 may inhibit apoptosis by suppressing the expression of Bid and Bad Bag-1 may also enhance apoptosis by inhibiting the expression of Bcl-2...

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-cycle regulator CDK4 and the S6b ATPase subunit of ... chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol- induced mucosal injury in the upper gastrointestinal tract leading to increase in the permeability of the gut...

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... healthy individuals Interestingly, this SNP had not yet been registered in any SNP databases despite of its high frequency of 20% in samples of patients with AML and 13,7% in healthy individuals After ... Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line Nature 2001;413(6853):316-22 Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki ... Behrens A The ubiquitin ligase SCFFbw7 antagonizes apoptotic JNK signaling Science 2004;303(5662):1374-8 Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R,...

Xem thêm

Từ khóa: proteomics analysis of human nonalcoholic fatty liver analysis of volatile compounds in the headspace of rice using spme gc ms proteomics analysis of mn9d cells with and witho answer the following questions that relate to the analysis of chemical compounds practical considerations for pharmaceutical analysis of chiral compounds new technologies for isolation and analysis of bioactive compounds substitution reactions of aromatic compounds bromination of aromatic compounds with alumina supported copper ii bromides uv vis absorption of aromatic compounds uv vis spectra of aromatic compounds 8aerobic degradation of aromatic compounds containing nitro or sulfonate groups microbial oxidation of aromatic compounds followed by chemical transformation analysis of oonounctions in pakser analysis of biological networks wiley series in bioinformatics give a critical analysis of the concept of self defence in public international law and international humanitarian law Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ