give a critical analysis of the concept of self defence in public international law and international humanitarian law



Chụp ảnh - Quay phim

... fact that a great number of philosophers, since the time of Plato up to our own day, have attempted to give a “correct” enunciation of the nature of art. They have notably maintained that art ... that the failure of Dickie’s institutional definition, which is certainly one of the most plausible candidates for carrying out the traditional project of Aesthetics in the contemporary era, can ... legitimately make us sceptical about the possibility of giving a substantial definition of art that would at the same time take into account contemporary artworks in all their variety. The second...
  • 8
  • 644
  • 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Báo cáo khoa học

... available, indicating secondary struc-tural changes in the linker connecting the dimerization and DNA-binding domains, and rearrangement of the relative orientation of the two domains [7,9]. The ... 1A) , indicating that the secondarystructure is not affected by the mutation or byAEDANS labeling. Thermal denaturation analysis of the protein variants suggests a lower stability of the mutant ... with the half site alsopresent in the operator in bold).Name Length (bp) Sequence1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT1DR 45 ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC1DR-short...
  • 15
  • 407
  • 0
The Role Of The United States Postal Service In Public Safety And Security doc

The Role Of The United States Postal Service In Public Safety And Security doc

Khoa học xã hội

... Safety and Security Training. USPS training is aimed at detecting and preventing mail crime, ensuring the security of the mail, and maintaining public safety. e safety and security of the mail at ... risk of increase for certain types of mail crime in particular, suspicious or hazardous incidents involving the mail.SummaryCurrently, the USPS and IS are doing much in the area of training ... JUSTICEEDUCATIONENERGY AND ENVIRONMENTHEALTH AND HEALTH CARE INTERNATIONAL AFFAIRSNATIONAL SECURITYPOPULATION AND AGING PUBLIC SAFETYSCIENCE AND TECHNOLOGYSUBSTANCE ABUSETERRORISM AND HOMELAND...
  • 221
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Y học thưởng thức

... guidelines for the management of patients with unstable angina and non-ST-segment elevation myocardial infarction. A report of the American College of Cardiology/American Heart Association Task ... statistical anal-yses. Categorical data are presented as absolute and relative frequencies, continuous variables as median withinter-quartile range (IQR). Since distribution of data of the continuous ... shock); ii) acute coronary syndrome (myocardialinfarction and unstable angina); and iii) all other admis-sion diagnoses. This division was made due to the factthat sepsis and acute coronary syndromes...
  • 8
  • 565
  • 1
Báo cáo y học:

Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

Y học thưởng thức

... Hunaid Hasan, Tasneem Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003  Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, ... No. 3910, Near Bombay Mercantile Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email: or Phone: ... of 730 participants between the ages of eighteen and thirty-nine years. 366 participants were from Aurangabad, India (AUR), and 364 participants were from Mississauga, Canada (MISS). The participants...
  • 12
  • 692
  • 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf

Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf

Sức khỏe trẻ em

... rather than the domains of the CHIP-CE when evaluating ADHD patients. This is supported by the factor analysis based on the sub-domains and the correlation analysis of the sub-domains, which ... deleted. The TA domain and the AP sub-domains were sensitive toTable 2 Spearman’s correlation coefficients with 95% CIs between the sub-domains and the domains and between the domains and the totalscore ... alpha(standardized) for the sub-domains and the lowest alphathat was reached by deleting anitem in that sub-domain with95% CIsSub-domains At baseline At endpoint For change frombaseline to...
  • 15
  • 1,081
  • 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Sức khỏe giới tính

... fullestparticulars regarding victors and vanquished, and thereare champions of the oar and the cricket-field whoseachievements are more familiar to the rising genera-tion than those of any general, statesman, ... Whether the training and exertion demanded of those who take part in the Uni-versity Boat-Race are of so trying a character that in numerous instances the constitution is liable to be per-manently ... became rather stiff till after the race, and then severe inflammation set in, in the elbow-joint,followed by abscesses; and, after three months in bed,pieces of bone came away, and I had the...
  • 419
  • 486
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) ... pattern. By coregulatingPK and LDH cells can maintain homolactic fermenta-tion. The fact that the effects of PK and LDH almostcancel each other out may also add to the explanation of why the...
  • 12
  • 556
  • 0


Cao đẳng - Đại học

... analysis does not assess the change in farm income due to the Renewable Electricity Standard and other provisions in HR 2454 that increase the demand for biomass and could provide additional ... grassland). Figure 4 shows the regional breakout of the potential carbon dioxide equivalent sequestered through afforestation on cropland and pastureland and through soil management at a carbon ... the impacts of House-passed climate legislation, HR 2454, on U.S. agriculture. The analysis assumes no technological change, no alteration of inputs in agriculture, and no increase in demand for...
  • 13
  • 588
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khoa học

... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the sameenzyme.To obtain an insight into ... 4.2–8.0 range, and a marked increase in Kmat alkaline pH(Table 2, Fig. 3). The D215N and D140N mutants displayed an acidicshift in the pH-activity profiles, whereas the Y214F and the E144Q mutants ... enzyme that, at least in part,results from the vicinity of Asp215 (Table 3, rows 1 and 4). The calculations indicate that the pK a of Glu144 isfurther, and somewhat drastically, increased upon...
  • 10
  • 575
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Báo cáo khoa học

... the x-axis denotes the degree of eachnode expressed as a fraction of the maximum de-gree and the y-axis denotes the number of nodeshaving a given degree expressed as a fraction of the total ... pages (Adamic and Huberman, 2000) and soon. Thus our inferences, detailed out in the nextsection, mainly centers around this power law be-havior.3 Inferences Drawn from the Analysis of PlaNet In ... large networks is governed by robust self- organizing phenomena that go beyond the particu-lars of the individual systems.Inspired by their work and the empirical as wellas the mathematical...
  • 8
  • 484
  • 0
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

Báo cáo khoa học

... EDTA, and 100 mm NaCl.Fig. 1. Alignment of 90-MtCM with AroQ a CMs. The alignment begins with amino acid 13 in 90-MtCM (the numbering begins with aminoacid 1 in the 90 amino acid protein). Amino ... of the two chains in the structure, which has a dimer in the asymmetric unit, and in the file 2D8E, which hasone chain in the asymmetric unit, all of the C-terminalresidues are seen. Another difference ... is a malate ionfrom the buffer in the active site of the enzyme. Malatemimics endo-oxabicyclic dicarboxylic acid, the transitionstate analog (TSA), in much the same fashion as citratethat...
  • 12
  • 448
  • 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

A Comparative Analysis of the Financing of HIV/AIDS Programmes docx

Ẩm thực

... HIV/AIDS-related activities. As mentioned, the two main sources of funding are the Ministry of Finance and Planning and donors. The Ministry of Finance and Planning allocates resources (as part of ... Hospital) and, through the provincial directorates of finance, to provincialadministration and from these to the district administration and/ or health facilities.Financing of HIV/AIDS is mainly ... South Africa,Swaziland and Zimbabwe. These countriesaccount for a third of PLWHA in sub-Saharan Africa compared to a tenth of the region’s population. The high level of financing in Botswana,...
  • 63
  • 285
  • 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

A Comparative Analysis of the Financing of HIV_AIDS Programmes doc

Khoa học xã hội

... Maziya – Swaziland•Brian Chandiwana – Zimbabwe The Departments of Treasury/Finance and the Departments of Health in the six countriesplayed an important role in the provision of information, without ... central agencies (e.g., Ministry of Health and MaputoCentral Hospital) and, through the provincial directorates of finance, to provincialadministration and from these to the district administration ... sources of information were Ministries of Finance/National Treasuries, Ministries of Planning, Ministries of Health, Tax Offices, National Income Accounts and NationalHealth Accounts, income/employment...
  • 63
  • 285
  • 0
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

A Comparative Analysis of the Financing of HIV_AIDS Programmes potx

Sức khỏe giới tính

... None of the countries studied have undertaken a ‘National HIV/AIDS Accounts’, as hasbeen done in other countries such as: Rwanda, Argentina, Brazil, and other LatinAmerican and Caribbean countries. ... programmes. Although most of the National Integrated Programme activities are based around the Department of Health, it is anticipated that in the next two to three years administration of the National ... report. Another data limitation was the paucity of information on household (and business) expenditure on HIV/AIDS.Estimates from Latin American and Caribbean countries found that averageannual...
  • 63
  • 294
  • 0

Xem thêm