0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Báo cáo khoa học:" Hepatitis B and C in dialysis units in Kosova" pps

Báo cáo khoa học:

Báo cáo khoa học:" Hepatitis B and C in dialysis units in Kosova" pps

... ymerelezi@hotmail.com; Teuta Bicaj - teutab68@yahoo.com* Corresponding author AbstractBackground: Hepatitis < /b> B virus (HBV) and hepatitis < /b> C virus (HCV) infections are important causesof morbidity and mortality ... uni-versal precaution standards and infection control meas-ures. Available data suggest that HCV has become themost common cause of acute hepatitis < /b> in dialysis patients and dialysis staff members, ... than HCV in HD units [4].The rate of serum HBsAg seropositivity on maintenanceHD in the developed world is currently low (0–10%) butoutbreaks of acute HBV infection continue to occur in thissetting....
  • 4
  • 346
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Hepatitis B and C in dialysis units in Kosova" docx

... developed world is currently low (0–10%) butoutbreaks of acute HBV infection continue to occur in thissetting. The prevalence of HBV infection within dialysis units in developing countries appears ... Seroprevalence of hepatitis< /b> B and C in maintenance dialysis in a public hospital in adeveloping country. S Afr Med J 2003, 93(5):380-384.15. Khan LA, Khan SA: Prevalence of Hepatitis < /b> B and C markers in patients ... uni-versal precaution standards and infection control meas-ures. Available data suggest that HCV has become themost common cause of acute hepatitis < /b> in dialysis patients and dialysis staff members,...
  • 4
  • 353
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis B virus genotypes and evolutionary profiles from blood donors from the northwest region of China" docx

... markers, including HBs, anti-HBs, anti-HBe, HBe and anti-HBs, were performed byELISA using an automatic enzyme detection system(Tecan, Swiss) and a commercial kit (InTec Products,China) according ... immediately upon acceptancecited in PubMed and archived on PubMed Central yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralVirology ... from blood donorcandidates from northwest China were determined. The HBV strains were most clustered into B and C genotypes and could not be clustered into similar types from reference sequences.Subsequent...
  • 7
  • 351
  • 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

... by bovine heartPKA. The sense primer (5¢-GTCGAATTCCAAGGTGAAGAACCCCAG-3¢) was located at nucleotides 63–90of the coding sequence, and the antisense primer (5¢-TGCTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢)over-lapped ... demaugre@necker.frAbbreviations: CRD, carbohydrate-binding domain; CRE, cAMPresponse element; HCC, he patocellular carcinoma; HMK peptide,peptide phosphorylatable by heart muscle kinase; PKA, cAMP-dependent ... zipper protein that interacts with c- Fos. Science 256, 1014–1018.18. Singh, H., Clerc, R.G. & L eBowitz, J.H. (1989) Molecular cloningof sequence-speci c DNA binding proteins using recognition...
  • 9
  • 310
  • 0
Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

... 5¢-AGGTACCCAATATTGGCCATTAGCC-3¢;CMVIE()507)5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢;CMVIE()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢;CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACGGGGATT-3¢;CMVIE()130) 5¢-TGGTACCTTGTTTTGGCACCAAAATCA-3¢ and 3¢ primer, CMV ... mNF-jB1, 5¢-GTAACGCCAATAtcGAtTTTCCATTG-3¢; mNF-jB2, 5¢-ACATGACCTTAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACTCAatcGatTTTCCAAGTC-3¢;mNF-jB4, 5¢-CCAAAATCAAatcGatTTTCCAAAATG-3¢;mAP-1,5¢-TAGCGGTTTatCgatCGGGGATTTCC-3¢. ... GC(indicated by bold lettering) are as follows: CpG-ODN1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2,TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCCATGAGCTTCCTGAGCTT). The non-CpG-ODN 2041(CTGGTCTTTCTGGTTTTTTTCTGG)...
  • 12
  • 330
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis B virus genotypes/subgenotypes in voluntary blood donors in Makassar, South Sulawesi, Indonesia" ppt

... | | AB033555-Indonesia- (B) ATGAGTGGGAGGAGTTGGGGGAGGAGATCAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCATGTTCATGTCCTATTGTTCAAGCCTCCAAGCTGTGC DQ993709-Taiwan- (B) ... CCGGCAGATGAGAAGGCACAGACGG HBX/HBPol 1549–1574HBPr374 Reverse GTTCCGCAGTATGGATCGGCAGAGG HBPol 1255–12794 (319) HBPr110 Forward CCTCTGCCGATCCATACTGCGGAAC HBPol 1255–1279HBPr113 Reverse CCGGCAGATGAGAAGGCACAGACGG ... associated with HCC was low [40].If BCP mutation is strongly associated with clinical out-come of liver disease including HCC, the incidence ofHCC must be high in India. In fact, the HCC incidencewas...
  • 9
  • 479
  • 0
Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

... permeation into desired tissues, speci c bindingto target cells and optimized intracellular trafficking.Recent advances clearly indicate that interdisciplinaryapproaches using biology, chemistry and ... and successfully inhibited theexpression of VEGF, thereby suppressing the growthof hepatocarcinoma tumors in mice [87]. In addition,no noticeable increase in inflammatory cytokines,including ... TAT–siRNA conjugates from the endosome, resulting in enhanced gene silencing efficiency. Chloroquine and Table 1. siRNA delivery systems for RNAi in vivo. BCL-2, B- cell lymphoma 2; Cyb1, cyclin B1 ; CyD1,...
  • 14
  • 599
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "COMMON TOPICS AND COHERENT SITUATIONS: INTERPRETING ELLIPSIS IN THE CONTEXT OF DISCOURSE INFERENCE" ppt

... supports Clinton, and Mary 0 Bush, and Fred does too. Sag defines an alphabeiic variance condition that cor- rectly predicts that sentence (25) is infelicitous, but in- correctly predicts that ... well with those employing our Common Topic inference, and likewise Cause or effect and Contiguity with our Coherent Situation inference. 9Following Hobbs, by al and bi being similar we mean ... to ] b. # Clinton was introduced by John because Mary had refused to, and Fred did too. [ in- troduced Clinton because Mary had refused to ] The current approach accounts for these cases....
  • 8
  • 511
  • 0
Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

... experiments in rats showed that corticalweight and thickness, however, increase with enrich-ment [21]. This increase in cortical size could be causedeither by enhanced dendritic branching and synapto-genesis ... enrichment include increases ofgreater than threefold, indicating increased capacityfor injury-associated plastic changes in the enrichedcortex [38].Environmental enrichment also causes molecularchanges ... E, Chase K, McIntyre C, BoyceFM, Campbell M, Cadigan BA, Warzecki L, TagleDA, Reddy PH et al. (2001) Changes in cortical and striatal neurons predict behavioral and electrophysio-logical abnormalities...
  • 15
  • 504
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx

... not include any such input-processingfactors in our models.Other objective factors that might be relevantfor predicting user satisfaction in the current studyinclude a range of non-verbal behaviour ... sub-jects built the windmill correctly, while both ofthe L-shapes were built with 90% accuracy. Forthe second occurrence of the snowman and the L-shape, the Memory column indicates the percent-age ... two classes of measures.Task success Table 3 shows the success rate forassembling each object in the sequence. Objects in italics represent sub-components, as follows:the first snowman was constructed...
  • 9
  • 310
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP