0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt

Báo cáo khoa học:

Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt

... protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/ or release of virionsYoko Ushijima, Fumi Goshima, Hiroshi Kimura and Yukihiro Nishiyama*Address: Department of Virology, ... that the interaction of the two proteins isdynamic and transient. Given that Nedd4 participates in many cellular trafficking activities including protein sort-ing and viral budding, UL56 can ... the data analysis and review of the manuscript.YN performed project planning, participated in the dataanalysis and helped to draft the manuscript. All authorsread and approved the final manuscript.Additional...
  • 13
  • 290
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... presumablysurface area into account, the radioactivity ratio representsthe ratio of extravascular to intravascular 67Ga radioactivity.The PLI represents the transport rate of 67Ga-transferrin fromthe ... 1-mmaluminium housing cover (35 mm in diameter and 40 mm in height). The front end of each probe has an aluminium flangeattached (3 mm in thickness and 70 mm in diameter) tofacilitate easy fixation ... cells, a pulmonary leak index can bemeasured as an index of capillary permeability and lunginjury. In 7 patients with HSV-1 from tracheal aspirateor bronchoalveloar fluid, the index was normal,...
  • 6
  • 284
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx

... R7 020 : A live attenuated recombinant herpes sim-plex virus (HSV) candidate vaccine. In Program and Abstacts of the 32nd Interscience Conference on Antimicrobial Agents and Chemother-apy American ... experiments and participated in drafting the manuscript, VNC participated in the construc-tion and characterization of the viruses, AB was involved in the design and conduction of in vivo studies, ATD ... mutants carrying the NV1 020 genomic deletion effectively inhibit primary and metastatic tumors in miceAnna Israyelyan1 ,2 , Vladimir N Chouljenko1 ,2 , Abolghasem Baghian1 ,2 , Andrew T David1 ,2 ,...
  • 10
  • 340
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf

... Forward TAGCAGTCATCCAACAGAATCATReverse AATCTTCTGAGTTGATTATGGGTAATLR4 Forward ACACAGAAGAGCTGGCATGAReverse GGTTGTCGGGGATTTTGTAGTLR9 Forward CTTCCCTGTAGCTGCTGTCCReverse CCTGCACCAGGAGAGACAGIFN-α(1/13) ... statistical analyses, and drafted the manuscript. RKM participated in the PCR and protein assays. HK participated in the PCR assays. EB,HSK, MW and TV participated in the design and coordina-tion ... finalmanuscript.AcknowledgementsWe thank Camilla Aspelin, Terhi Helander, Marja-Leena Mattila, Outi Rauta and Johanna Vänni for expertise in the laboratory and Tero Vahlberg for assistance with statistical analysis. This...
  • 11
  • 361
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Herpes simplex virus infection in pregnancy and in neonate: status of art of epidemiology, diagnosis, therapy and preventio" potx

... including live and inactivated whole virus vaccines and subunit vaccinesconsisting of recombinant viral glycoproteins in variousadjuvants [ 72] .Although animal studies on vaccination strategies to ... genital and neonatal herpes may be promising, clin-ical trials of HSV -2 vaccines in humans have failed toprove efficacy. In a previous study, an HSV -2 glycoproteinD vaccine using alummorpholine ... days, is usually important and prolonged (up to 21 days) [2, 11]. Within women itcauses blistering and ulceration of the external genitalia and cervix leading to vulval pain, dysuria, vaginal...
  • 11
  • 281
  • 0
Báo cáo y học:

Báo cáo y học: " Herpes simplex virus UL56 interacts with and regulates the Nedd4-family ubiquitin ligase Itch" pps

... virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/ or release of virions. Virol J 20 09, 6:168.13. Dolan A, Jamieson FE, Cunningham C, Barnett ... Nedd4- family ligases: an amino-terminal C2 domain;four protein- protein interacting WW domains, whichmost commonly recognize PY motifs of binding pro-teins; and a carboxyl terminal catalytic ... Ca 2+ /lipid binding C2 domain, four WW domains that interact with PY motifs, and a catalytic HECT domain. HSV UL56 (HSV-1, 23 4aa; HSV -2, 23 5 aa) contains three PY motifs and a predicted transmembrane...
  • 11
  • 285
  • 0
Báo cáo khoa học: Chain initiation on type I modular polyketide synthases revealed by limited proteolysis and ion-trap mass spectrometry doc

Báo cáo khoa học: Chain initiation on type I modular polyketide synthases revealed by limited proteolysis and ion-trap mass spectrometry doc

... mLÆmin)1. LM,loading module fragment comprising the didomain ATL-ACPL;ACP1-M2, tetradomain fragment containing domains ACP1-KS2-AT2-KR2; KR5-ACP5-M6, multidomain fragment containing ... N-terminalsequencing analysis. The acyltransferase-acyl carrier protein required forchain initiation (ATL-ACPL), was released as a didomain from bothDEBS1-TE and DKS, as well as the off-loading ... werereleased either as individual domains or as a pair of domains. The loading module was released as the sta-ble didomain ATL-ACPL, and was resistant to furtherdigestion. KR1 and TE were released...
  • 15
  • 210
  • 0
Báo cáo y học:

Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot

... cholesterol transport from macrophages. PLoS Biol 20 06, 4(11):e365.44. Tokunaga K, Kojima A, Kurata T, Ikuta K, Akari H, Koyama AH,Kawamura M, Inubushi R, Shimano R, Adachi A: Enhancement of human immunodeficiency ... protein was held constant. ethanol/cholesterol/cyclo-dextrine was added in increasing amounts up to a molarratio of protein to ligand of 1 to 2. Competing interestsThe author(s) declare that ... composition.Proc Natl Acad Sci U S A 20 06, 103(8) :26 41 -26 46.39. Pulkkinen K, Renkema GH, Kirchhoff F, Saksela K: Nef associateswith p21-activated kinase 2 in a p21-GTPase-dependentdynamic activation complex...
  • 12
  • 384
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx

... on day 1 (r 2 = 0 .28 , n = 40, p = 0.0003). In addition, SOFATable 1Locus PrimerDDAHII-449 Allele 1 GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGGAllele 2 GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGCCommon ... dimethyl-arginine (ADMA) using a novel ELISA assay. Clin Chem LabMed 20 04, 42: 1377-1383.19. Vallance P: Importance of asymmetrical dimethylarginine in cardiovascular risk. Lancet 20 01, 358 :20 96 -20 97. 20 . ... genotype analysis, sta-tistical analysis and drafting of the manuscript. TR participated in the design of the study, patient recruitment, statistical anal-ysis and drafting of the manuscript. All...
  • 7
  • 265
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx

... cases.§Data was only available for 31 out of 34 cases. ¥Data was only available for 28 out of 29 cases. ∞Data was only available for 26 out of 29 cases. ØData was only available for 27 out of ... of 29 cases. ¤Data are only available for 16 out of 29 cases. €Data was only available for 38 out of 39 cases. ∂The data was only available for 36 out of 39 cases. ΩData was only available ... for 26 out of 30 cases. ΨData was only available for 28 out of 30 cases. θData was only available for 18 out of 30 cases for NPC plasma samples. Data was only available for 31 out of 32 cases...
  • 10
  • 356
  • 1

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP