Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... substantial apoptotic tumor cells for DC loading. Because both activated mono-cytes and apoptotic malignant T cells are obtained indi-vidually and can be re-added after treatment, the optimalconditions ... essentially as describedby the manufacturer.Statistical evaluationThe expression of DC markers and the MLC response wasevaluated statistically by the student's t test or if the datawas ... exogenousmaterial into the class I pathway for presentation to CD8 T cells. Our simple approach to rapid DC vaccine con-struction takes advantage of both physical stimulation and production of apoptotic...
- 16
- 251
- 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... complete encapsulated tumors do not require anyTable 4: Univariate and multivariate analysis of cancer-related survival in the total population a Risk factor Univariate analysis Multivariate analysiscp ... chemotherapy and/ or radiation therapy,33 patients were taken into an adjuvant therapy regime. Indetail, 3 patients were either treated alone with neoadju-vant chemotherapy or radiation alone, ... was carried out to determine an advan-tage for patients with neoadjuvant or adjuvant treatment.Table 3: Patient characteristics and tumor parameters according to the presence of a pseudocapsula a Characteristics...
- 10
- 355
- 0
Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot
... not infect intact cells and aretransmitted vertically by intracellular routes (meiosis and mitosis) and horizontally by anastomosis of compatiblehyphae or through sexual mating of yea st cells. ... small amounts of yeasts ormicelia a s initial material to obtain a sufficient quantity of dsRNA that can later be analyzed by electrophoresisin agaro se gel, quantified by densitometric analysis, ... analysis, and treated with enzymes for their partial characterization.ThemethodallowsgettinghighqualitydsRNA,freeofDNA and ssRNA, and it can be applied to isolatedsRNA from a ny type of fungus or any...
- 7
- 319
- 0
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx
... Reactivity was demonstrated using an Ouchterlony geldiffusion assay and demonstrated reactivity at 1 mg/mlagainst rabbit anti-goat IgG (data not shown). Purity and extent of digestion was determined ... fatality rate. When left untreated gastrointestinalinfections can progress rapidly and have over 80% casefatality rates. Inhalation anthrax infections are rare buthave a high case fatality rate (over ... with antibi-otic treatment.Treatment options for patients presenting with symptoms of inhalational anthrax infections are limited and are gen-erally ineffective at reducing mortality. Although...
- 8
- 312
- 0
Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc
... and ELISA,real-time PCR offers an eff ective way to detect targetfragments specifically, rapidly and quantitatively. False-positive re sults and pollution can be prevented eff ec-tively at ... and a TaqMan probe for PCV2. We have estab-lished an assay that is specific and sensitive fordetection and quantitation of PCV2.Materials and methodsDesign of primers and TaqMan probeThe ... specificity of the assayThe standard PCV2 plasmid with 107,105 and 103copies was used to evaluate the coefficients of variation(CVs) of the real-time PCR. Int ra- and int er-assay CVsfor Ct values...
- 5
- 389
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... GGCTTCTCCGGGTTTTTCTTCCTA 24371f CCCGGGTTGAAAAGCCTCGTGT 22 371b371r TGTAACTTATCCTCCCTGAATCTG 24 a Length of product amplified by one step real-time RT-PCR primer pair.bLength of product amplified by conventional ... region of PRRSV N gene.Results: The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch- 1a RNA for the generation of a standard curve. The detection limit of the assay was ... times. Ct values were measured in triplicate and were plotted against the amount of infectious units (Fig.1). The inter-assay calibration curves in Fig. 1 indicatethat a linear detection range...
- 7
- 350
- 0
Báo cáo y học: "Rapid development of intestinal cell damage following severe trauma: a prospective observational cohort study" doc
... using a Kryptor-Assay (Brahms, Henningsdorf, Germany).Statistical analysisFirst, the plasma i-FABP levels of all trauma patients on admit-tance and at days 1 and 2 were compared with healthy controlvalues. ... presentation at the ER.• The presence of shock and the severity of local and overall injury are related to the extent of early intestinal cell damage.• Early plasma values of intestinal epithelial ... healthycontrols.The extent of intestinal cell damage is related to presence of shock and injury severityTo investigate the relation between hemodynamic stability and intestinal cell damage,...
- 7
- 165
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the ... amount of antibiotic consumption as total weight (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer data-bases, and 2) International Medication System (IMS). ... effect of NARP on antibiotic consumption, antimicrobial resistance, and cost. Materials and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care...
- 6
- 692
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... ataP10 and ataP7. The two additionalones were named ata12 and ataPKS1 (Figs 2 and 3). Allshared a codon usage and a G+C content at the thirdposition typical of Streptomyces [28]. Other characteristics of ... complementa-tion assays. The ataP5, ataP4 and ataP10 genes were alsoindependently inserted in the pIJ702 vector and the resultingplasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively(Materials and methods), ... orientation(Figs 2and 3A) .Ofthese,five(ataP3, ataP5, ataP4, ataP10 and ataP7) are highly similar to known or putative genesthat are known or proposed to be implicated in thebiosynthesis of the aminonucleoside...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... polyacrylamide gels, blotting t o nitrocellulose and probing with antip26 antibody before scanning. Eachdensitometer value (arbitrary units) was plotted against theamount of cell free extract ... linear portion of a standard curveestablished for quantitation o f p26. The standard curvewas prepared by electrophoresing different amounts of cell free extract from Artemia cysts containing ... and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously developing embryos of the brine shrimp,Artemia franciscana, synthesize abundant quantities...
- 10
- 495
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015