0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

Báo cáo khoa học: Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge potx

... 2010 The Authors Journal compilation ª 2010 FEBS Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge Department ... amide groups of Ile128 and Arg129.Despite these differences in the coordination of the res-idues in the tip, the fold of the loop is strikingly simi-lar. The rmsd for the Ca atoms of the residues ... aeolicus) and 292 ⁄ 306 (T. thermophilus) allow rotation of the KMSKS loop. The two positions of the loop correspond to a rotation of  90°.H. Ingvarsson and T. Unge Crystal structure of M. smegmatis...
  • 16
  • 514
  • 0
báo cáo sinh học:

báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

... AccessResearch HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern TanzaniaSebalda C Leshabari*1,2, Astrid Blystad2,4, Marina de Paoli5 and Karen M Moland2,3Address: ... beentrained specifically in HIV and infant feeding counselling,while sixteen had received four weeks of orientation train-ing for general HIV counselling. Eleven had also beentrained in breastfeeding ... questions for formative research on HIV and infant feeding [33]. In- depth interviews aimed at eliciting individual percep-tions and experiences with infant feeding counselling,while FGDs were to explore...
  • 11
  • 540
  • 0
báo cáo sinh học:

báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

... CentralPage 1 of 9(page number not for citation purposes) Human Resources for HealthOpen AccessResearch Measuring and managing the work environment of the mid-level provider the neglected human ... motivation and performance of mid-level providers. This paper explores the work environment of mid-level providers in Malawi, and contributes to the validation of an instrument to measure the work environment ... indication of the inade-quacy of adopting a strategy of training and employing mid-level cadres in the absence of strategies to strengthen and improve other aspects of the health environment...
  • 9
  • 455
  • 0
báo cáo sinh học:

báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot

... support and coopera-tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... rates are high and before ART was available, death was a common cause of attrition among district health care workers [14,15]. A recent South African survey measured HIV prevalence among health ... study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage-ment and data entry assistance. We acknowledge the Zambian Ministry of Health for consistent...
  • 10
  • 501
  • 0
báo cáo sinh học:

báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf

... for Health Open AccessResearch Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, BrazilMaria Cristina Ramos de Vasconcellos ... competing interests.Authors' contributionsMC, AA and SB jointly formulated the study design. MCobtained the data. MC and AA were involved in the con-ceptualization, initial drafts and final ... gratefully acknowledge the assistance of Dra. Ana Flavia Mach-ado, Professor of Demography at the University of Minas Gerais, in analysis of the data and for her helpful comments and editing.This...
  • 13
  • 544
  • 0
báo cáo sinh học:

báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

... Communication Programs (PAIMAN), Islamabad, Pakistan and 2 Health Systems and Policy Unit, Federal Ministry of Health, Islamabad, PakistanEmail: Zaeem Haq* - drzaeem@hotmail.com; Assad Hafeez - az10@hotmail.com* ... and communication needs assessment of community health workers in a developing country: a qualitative studyZaeem Haq*1 and Assad Hafeez2Address: 1Johns Hopkins University Centre for Communication ... Government of Pakistan: Internal Assessment of Lady Health Workers& apos; Programme 2007 Islamabad: National Programme forFamily Planning and Primary Health Care; 2008. 12. Oxford Policy Management:...
  • 7
  • 438
  • 0
báo cáo sinh học:

báo cáo sinh học:" Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives of system actors" ppt

... 1 of 11(page number not for citation purposes)Human Resources for Health Open AccessCase study Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives ... audio-recorded by a team of three field researchers. Informed consent for all inform-ants was obtained prior to the beginning of the interview.The selection of informants in the qualitative componentwas ... manuscript.Authors' informationGN is Director of Health Services and Systems Innova-tions, Health Systems Research Centre, National Institute of Public Health. LG is a Researcher, Health SystemsResearch...
  • 11
  • 420
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

... AccessResearch Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single sourceLachlan Gray1,2, Melissa J Churchill1, Jasminka ... DG, ALC, DAM and PRG analyzed and interpreted the data; PRG designed and oversaw the study, and wrote the manuscript. Allauthors read and approved the manuscript.AcknowledgementsWe thank J. ... Medical Research Council of Australia (NHMRC) to PRG (251520), a grant from the American Foundation for AIDS Research (amfAR) to DAM (106669), and grants from the National Institutes of Health...
  • 12
  • 401
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India" potx

... AntimicrobialsOpen AccessResearchEtiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, IndiaMohammed Akram1, Mohammed Shahid2 and Asad ... usedantimicrobilas among pathogens of both bacteremic and non-bacteremic community-acquired urinary tract infec-tion. J Microbial Immunol Infect 2004, 37:185-191.27. Colodner R, Keness Y, Chazan ... Fluoroquinolones, Co = Cotrimoxazole, T = Tetracycline,Nf = Nitrofurantoin, Car = Carbapenems.Annals of Clinical Microbiology and Antimicrobials 2007, 6:4 http://www.ann-clinmicrob.com/content/6/1/4Page...
  • 7
  • 320
  • 0
Báo cáo y học:

Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

... activation and aggrecan and collagen release.Materials and methods Cartilage degradation assayBovine nasal cartilage was cultured as previously described[20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297GGTACCCGTAGAGCTTCCGTTCCα2M GCCCGCTTTGCCCCTAACA 359TCGTCCACCCCACCCTTGATGRECK GTAATTGCCAAAAAGTGAAA 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 GCTGCCCTCACACTGCGGAAC 264CATCATGGGGCATGTTAAACACADAMTS-4 ... 287AATAGCTTTACGGGTTTCAGGTIMP-1 TGGGCACCTGCACATCACC 277CATCTGGGCCCGCAAGGACTGTIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277TGTCCCAGGGCACGATGAAGTCTIMP-3 GATGTACCGAGGATTCACCAAGAT 356GCCGGATGCAAGCGTAGTTIMP-4 ATATTTATACGCCTTTTGATTCCT...
  • 12
  • 526
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Feasibility and early clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatments" pptx

... [http://ctep.cancer.gov].doi:10.1186/1748-717X-6-113Cite this article as: Scorsetti et al.: Feasibility and early clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatments. Radiation Oncology 2011 ... Vanetti2 and Luca Cozzi2AbstractPurpose: To test feasibility and safety of clinical usage of Flattening Filter Free (FFF) beams for delivering ablative stereotactic body radiation therapy (SBRT) ... clinical assessment of flattening filter free (FFF) based stereotactic body radiotherapy (SBRT) treatmentsMarta Scorsetti1, Filippo Alongi1*, Simona Castiglioni1, Alessandro Clivio2, Antonella...
  • 8
  • 315
  • 0
Báo cáo y học:

Báo cáo y học: "Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" ppsx

... implementing MDI/spacer research and to identify factors associated withearly and late adoption of MDI/spacers in Canadian PEDs.Methods: Using a comparative case study design, we classified nine ... process. While individual clinicians maybe aware of the advantages of MDI/spacer use, the actually'adoption' of MDI/spacers is actually an institutional ordepartment decision because it ... study were to determine thebarriers and supports to implementing MDI/spacers intoPED practice, and identify factors associated with early and late adoption of MDI/spacers in PEDs in Canada.MethodsDesign...
  • 10
  • 308
  • 0
báo cáo khoa học:

báo cáo khoa học: " Barriers and supports to implementation of MDI/spacer use in nine Canadian pediatric emergency departments: a qualitative study" pps

... cov-ered, as well as the initial coding of the data and theorganization of the emergent barriers and facilitators.Data were used to make cross-case (i.e., pediatric ED to pediatric ED) and cross-category ... study were to determine the barriers and supports to implementing MDI/spacers intoPED practice, and identify factors associated with early and late adoption of MDI/spacers in PEDs in Canada.MethodsDesign ... innovation adoption demands. Clinical treat-ment and management of children's asthma exacerba-tions are engrained decisions and behaviours that areshaped by factors at the individual practitioner,...
  • 10
  • 330
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Antibacterial and resistance-modifying activities of thymoquinone against oral pathogens" ppsx

... resistance-modifying activities of thymoquinone against oral pathogens. Annals of ClinicalMicrobiology and Antimicrobials 2011 10:29.Submit your next manuscript to BioMed Central and take full advantage of: ... Annals of Clinical Microbiology and Antimicrobials 2011, 10:29http://www.ann-clinmicrob.com/content/10/1/29Page 5 of 7RESEARC H Open AccessAntibacterial and resistance-modifying activities of thymoquinone ... vitroantibacterial activity of the volatile oil of Nigella sativa seeds against multiple drug-resistant isolates of Shigella spp. and isolates of Vibriocholerae and Escherichia coli. Phytotherapy...
  • 7
  • 220
  • 0
Báo cáo y học:

Báo cáo y học: "Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury" docx

... al.: Acute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injury.Critical Care 2011 15:R2.Submit your next manuscript to BioMed Central and take ... AccessAcute and delayed mild coagulopathy are related to outcome in patients with isolated traumatic brain injurySjoerd Greuters1*, Annelies van den Berg1, Gaby Franschman1, Victor A Viersen1, ... injury and coagulopathy doubles within 72hours post-trauma and is closely associated with poor patient prognosis.• Early diagnosis of coagulopathy in isolated trau-matic brain injury may contribute...
  • 7
  • 314
  • 0

Xem thêm

Từ khóa: báo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcbáo cáo sinh học phân tửchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ