0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

Báo cáo khoa học: Biochemical characterization of a U6 small nuclear RNA-specific terminal uridylyltransferase potx

... 5¢-TTTAATACGACTCACTATAGGGTGCTCGCTTCGGCA-3¢ as upstream primer and5¢-TATGGAACGCTTCACGAATT-3¢ (U6- 0), 5¢-ATATGGAACGCTTCACGAATT-3¢ (U6- 1) or 5¢-AATATGGAACGCTTCACGAATT-3¢ (U6- 2) as downstream primer,respectively. ... HeLa cell terminal uridylyltransferase (TUTase) thatspecifically modifies the 3¢-end of mammalian U6 small nuclear RNA (snRNA) was characterized with respect toionic dependence and substrate ... position of labeled U6 snRNA is indicated by an arrow and ÔmÕrepresents labeled marker DNA.Ó FEBS 2003 Characterization of U6 terminal uridylyltransferase (Eur. J. Biochem. 270) 973lane 3, and a...
  • 10
  • 531
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu Ofrom Corynebacterium ... Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, but not iden-tical,...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... their absorbance at 260 nm. Peak 3 produced small amounts of HMG-CoA and large amounts of free CoA. Peak 4 produced HMG-CoA and also large amounts of free CoA. Peak 5 produced large amounts of HMG-CoA, ... (1999) Characterisation and mitochondrial localisa-tion of AUH, an AU-specific RNA-binding enoyl-CoAhydratase. Gene 228, 85–91.17 Nakagawa J & Moroni C (1997) A 20-amino-acidautonomous RNA-binding ... revealed a 32 kDa AUH protein and it was thus assumed thatthe mature form of human AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For thekinetic characterization of AUH described...
  • 11
  • 625
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosome was amplified byPCR using chromosomal B. subtilis DNA as template andthe oligonucleotides 5¢-TTGGTGGGATCCGTGACTCGAGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCGACTTATCGCACACTATAGCTTGATG-3¢ as primers(restriction ... humanpathogens.Enterococci and Staphylococci have a dramatic history of resistance development against virtually all currently avail-able antibiotics. Most notably, many strains are multidrugresistant, and the rapidly ... theaddition of EDTA to a final concentration of 26 mM.Afterthe addition of D2O to a final concentration of 10% (v/v),the samples were analysed by NMR spectroscopy.Assay of lactate dehydrogenase activityAssay...
  • 12
  • 692
  • 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx

... identifi-cation was performed by searching the MS data against a curated version of the International Protein Index Biochemical characterization of USP7 A. Ferna´ndez-Montalva´n et al.4266 ... supplementary material is availableonline:Fig. S1. Analysis of USP7 oligomerization in vitro andin cells.Fig. S2. Substrate titrations of USP7 variants.This material is available as part of the ... mammalian cells hadan N -terminal 3XFLAG tag and a C -terminal Myc tag. USP7-FL con-structs used for proteomics analysis contained either N- or C-termi-nal CBP-Protein A tags separated by a...
  • 15
  • 592
  • 0
Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

Báo cáo khoa học: Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans pot

... CCAACTTATGTCCCGACTCTGCATCTGTGAAAGTCaDHODH-rev, CCGGAATTCCTTATCATCAGAGCCAATTATCa-BamHI-for, GCGGATCCCGAATGTTTCGTCCAAGTATCAAATTCAAACAGTCGCak-BamHI-for, GCGGATCCCGAATGTCAAGATCAGCAATCCATGAATATGTTTTGTGCCaDHODH-rev3, CCGGAATTCTCACTTATCATCAGAGCCAATTATTTGCTCCCATGExpression ... ATGTTTCGTCCAAGTATCAAATTCZGCaURA1–3¢, TCACTTATCATCAGAGCCCa-forlong2, ATGTTTCGTCCAAGTATCAAATTCAAACAGTCGACTTTGTCCCaKDHODH-mutfor1, CACAGATGCAGAGTCGGGACATAAGTTGGGGGTTCaKDHODH-mutrev1, CCAACTTATGTCCCGACTCTGCATCTGTGAAAGTCaDHODH-rev, ... number of antifungal agents are available. In addition, theseorganisms are becoming resistant to current classes of antifungal agents, particularly the azoles [2]. Expres-sion of efflux pumps that...
  • 9
  • 458
  • 0
Báo cáo khoa học: Biochemical characterization of annexin B1 from Cysticercus cellulosae pdf

Báo cáo khoa học: Biochemical characterization of annexin B1 from Cysticercus cellulosae pdf

... of annexin proteins in health anddisease are increasingly being appreciated and the term‘annexinopathies’ has been put forward for annexin-related diseases. In particular, the importance of annexin ... affinity of the interactionwith heparin. Subsequent binding of annexin A5 to themembrane surface releases the glycosaminoglycan from A. Winter et al. Biochemical characterization of annexin ... coordinates a variety of cellular functions. Heparan sulfate has a variable hep-arin-like structure but more N-acetylated and fewerN-orO-sulfonated groups than heparin. Heparin itselfis a highly...
  • 10
  • 388
  • 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relativeabundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... filtration chromatography and GLC were carried out asdescribed previously [16].Preparation of OS materialO-Deacylation of LPS. O-Deacylation of LPS wasachieved with anhydrous hydrazine, as described ... R.,Moxon,E.R.&Richards,J.C.(2002) Identification and structural characterization of a sialylatedlacto-N-neotetraose structure in the lipopolysaccharide of Hae-mophilus influenzae. Eur. J....
  • 13
  • 433
  • 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...
  • 11
  • 501
  • 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Russia, eastern Asia, Austra-lia, and New Zealand, and has the potential totransmit pathogens including viruses, rickettsia andprotozoan parasites that cause important human andanimal diseases ... M. K. Islam1,M. A. Alim1and Kozo Fujisaki2,31 Laboratory of Parasitic Diseases, National Institute of Animal Health, Ibaraki, Japan2 National Research Centre for Protozoan Diseases, Obihiro ... 34,799–808.45 Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B,Xuan X & Fujisaki K (2006) Molecular cloning andfunctional characterization of an aspartic protease fromthe hard tick Haemaphysalis longicornis....
  • 14
  • 432
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM