0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth structure and function of the second kinase noncatalytic C-lobe domain docx

... activity of v-KIND induces the phosphoryla-tion of MAP2 by JNK1 and ⁄ or ERK via the activation of the Ras–Raf–MAP kinase pathway [12]. These resultsappear to be in agreement with those of previous ... region. The C-lobe of protein kinases mediates the interaction with activators, substrates and regulatorysubunits, implying that the KIND domain, an atypicalnoncatalytic C-lobe, is involved in the ... Furuichi1,2,41 Laboratory for Molecular Neurogenesis, RIKEN Brain Science Institute, Saitama, Japan2 JST, CREST, Kawaguchi, Saitama, Japan3 Research Institute of Pharmaceutical Sciences, Musashino University,...
  • 11
  • 658
  • 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 a molecular link between recombination and chromatin assembly during meiosis pot

... subunit of CAF-1 a molecular link between recombination and chromatin assembly during meiosis Satomi Ishii*,†, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata,Kengo Sakaguchi ... cloning of CcCac1L and its interaction with CcLim15. (A) Schematic diagram of the CAF-1 large subunits in human, C. cine-rea and S. cerevisiae. The KER and ED domains are represented by black and ... exonu-clease activity and invades the homologous double-stranded region of the other allele. These steps of homology search and recombination are catalysedby two bacterial RecA homologues, Rad51 and Lim15/Dmc1. ...
  • 10
  • 487
  • 0
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx

Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx

... than 50% of the GlnK–TnrA interaction in the presence of 2 mm ATP.On the other hand, 2-oxoglutarate did not influence the GlnK–TnrA interaction, either alone, in the absence of divalent metals, ... molecules, and the mixture was used as an analyte in SPR analysis. ATP and 2-oxoglutarate are known to be the primary effec-tors involved in PII signaling, and they strongly affectinteractions of many ... C-terminus of TnrA, and may play a role in the regulation of TnrA activity and its proteo-lysis [15]. To test this assumption, various truncations of TnrA (lacking six, 20 and 35 amino acids from the C-terminus)...
  • 11
  • 596
  • 0
Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

... and BSA as standard. Rabbit poly-clonal antibodies for TIPRL (A3 0 0–6 6 3A) , PP2Ac (A3 0 0– 73 2A) and a4 (A3 0 0–4 7 1A) were used in immunoprecipita-tion assays, and antibody for murine MafB (A3 0 0–6 1 2A) ,which ... independent of the canonical A and B regulatory subunits.Type 2A phosphatases are key players in the yeasttarget of rapamycin (TOR) signaling pathway [3].Although Tap42 was characterized as a regulator ... type 2A phosphatases, playing antagonistic roles in the target of rapamycin signaling pathway. a4 and target of rapamycin signaling pathwayregulator-like (TIPRL) are the respective mammalian orthologs...
  • 14
  • 418
  • 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

... in the appearance of an additional peak at 7.65 mLon the elution profile. Increase of the temperature of incubation was accompanied by the simultaneous increase of the peak eluted at 7.65 mL and ... were scanned and evaluated by the ONEDSCANprogram. The intensity of the band of unhydrolyzed actin was plotted against the time of incubation.Characterization of actin preparation qualityFluorescence ... effect of the 3D mutant of HSP25on the initial rate of actin polymerization can be explainedby the prevention of nonspecific aggregation of partiallydenatured actin that can trap intact actin. The...
  • 10
  • 431
  • 0
Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc

Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc

... [ibuprofen],respectively, and kþoffis the koffvalue obtained in the absence of ibuprofen.Data analysisKinetic and thermodynamic data were analyzed with the matlab program (The Math Works, Natick, MA, USA). The ... FA1 and the ligand-binding pockets FA2 and FA6, all located in domains I and II of (t)HSA.AbbreviationsFA, fatty acid; HSA, human serum albumin; HSA–heme-Fe, human serum heme-albumin; HSA–heme-Fe(III), ... of tHSA–heme and HSA–heme by binding to the low-affinity secondarysites FA2 and FA6 rather than associating with the primary-high affinity cleft FA3–FA4; and (b) reinforce the idea that HSA could...
  • 9
  • 489
  • 0
Báo cáo khoa học: Cysteine residues exposed on protein surfaces are the dominant intramitochondrial thiol and may protect against oxidative damage docx

Báo cáo khoa học: Cysteine residues exposed on protein surfaces are the dominant intramitochondrial thiol and may protect against oxidative damage docx

... this, the exposed thiol willpreferentially sustain the oxidative damage, ratherthan another amino acid, as a result of its greaterreactivity with most damaging species, thereby actingas a local ... on the surface of proteins are the dominant intracellular thiol and that they may play animportant role in intracellular antioxidant defences.ResultsQuantification of exposed protein thiols and ... lg of protein was separated by SDS-PAGE and immunblotted using an antibody against 3-nitrotyrosine. The blot was reprobed using antisera against the 75 kDa and 51 kDacomplex I subunits and...
  • 16
  • 379
  • 0
Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx

Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx

... helices, a1 a4 (Fig. 2B). Strand b3has a substantial twist at residues 16 8–1 69. The longest a- helix (a1 ) starts at the end of the GGQ loop and has a bend at residues 19 5–1 96. There are also severalloops ... graphical comparison of the experimentallymeasured parameters against simulated datasets (Fig. 4).Data indicated by gray squares were simulated using the extended Lipari and Szabo [37] and axially ... understand the roles of the mid-dle domain of the eukaryotic class 1 polypeptide chain release factor in the transduction of the termination signal from the small to the large ribo-somal subunit and...
  • 15
  • 538
  • 0
Tài liệu Báo cáo khoa học : Bản chất của khủng hoảng kinh tế thế giới pdf

Tài liệu Báo cáo khoa học : Bản chất của khủng hoảng kinh tế thế giới pdf

... hoang ba't ddng san d Hoa Ky. Bay gid ngUdi ta cho rang nguyen nhan cua ta't ca cac KH nay la sii dau cd cua cac ngan hang va cdng ty da qud'c gia de bu vao cai da ma't ... cac nfldc dang phat trien (A. Panagaraya, 2005): 1. Cac nUdc da phat trien bao ve bien gidi va trd cap rat cao. 2. Trd ca'p va bao ve ciia cac nUdc da phat trien ra't cd bai ... nay la ciia cac dang Xa hdi dan chii, each day khoang 10 nam da nam quyen lanh dao d hau het cac nfldc Chau Au. Tuy vay trfldc cudc KH nay khdng cd mot dang xa hdi nao dfla ra...
  • 14
  • 909
  • 1
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... holoenzyme/apoenzyme (Table 1), the stability of the protein was affected by each of the mutationsTable 4. Apparent a nity of DDT and testosterone for CYP 6A2 wt and CYP 6A2 vSVL. For each apparent a nity calculated, ... in all lanes loadedwith bacterial protein. The CYP 6A2 variants have the same apparentmolecularmassasCYP 6A2 fromD. melanogaster microsomes. The apoenzyme production varied among the variants. No ... (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were insertedin pCW between the NdeIandXbaI restrictions sites. The CYP 6A2 vSVL enzyme was...
  • 8
  • 535
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam