0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae Malea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... product of the ARO10 gene from Saccharomyces cerevisiae was ini-tially identified as a thiamine diphosphate-dependent phenylpyruvate decar-boxylase with a broad substrate specificity. It was suggested ... phenylpyruvate decarboxylase from Azospiril-lum brasilense and the indolepyruvate decarboxylase from Enterobacter clo-acae. We show that the properties of the two phenylpyruvate decarboxylases...
  • 12
  • 436
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...
  • 14
  • 523
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Marchese, S., Brandazza, A. ,Ferrara, L., Pelosi, P. & Scaloni, A. (2001) Bacterial expressionand conformational analysis of a chemosensory protein from Schistocerca gregaria. Eur. J. Biochem....
  • 11
  • 642
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...
  • 12
  • 772
  • 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) Theamino acid sequence of the beta chain of ... importantly, two localmaxima of  330 and 380 nm were also revealed.These maxima are typical of diiron-centre absorbance,and thus characteristic for all haemerythrins [12]. Thisstrongly indicates ... N-terminally or MS-identified spots.Approximate molecular masses and pI values are indicated to the left and at the top of the gels, respectively. Characterization of prokaryotic haemerythrin O. A. ...
  • 13
  • 501
  • 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... specific radioactivity of the125I-labelledPA1b, calculated by the ratio of the radioactivity measuredby gamma counting and the amount of peptide evaluated byabsorbance at 210 nm during HPLC analysis, ... PA1b: five susceptiblestrains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamaisLS, and S. granarius BrayardÕ and four fully resistantS. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, Cambridge, UK), and plots were drawn using theORIGIN 5 software (Microcal,...
  • 7
  • 604
  • 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... APN1AAF08254 HviAAN75693 Har APN1AAF37558 Hpu APN1AAC33301 Bmo Q11001 Mse A pisum APNCAA66467 PxyAAX39864 Tni APN2AAD31184 Ldi APN2BAA32140 Bmo P91885 Mse APN2CAA10950 PxyBAA33715 BmoAAX39866 ... 499–508.19 Rajagopal R, Agrawal N, Selvapandiyan A, SivakumarS, Ahmad S & Bhatnagar RK (2003) Recombinantlyexpressed isoenzymic aminopeptidases from Helicoverpaarmigera(American cotton...
  • 15
  • 391
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... theabnormal accumulation of intracellular acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application inchemoselective and racemization free deacylation ... Coo-massie blue, 2-mercaptoethanol, etc. were purchased from Sigma-Aldrich, St Louis, MO, USA.Bacterial strainThe strain isolated from soil samples was identified as a bacterium, A. faecalis according...
  • 14
  • 513
  • 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletionDFKRP 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletionCAT1 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacementCAT2 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ ... PurposeSTKP-F 5’-AGGATGCCATATGATCCAAATCGGCAA-3’ NdeI stkP expressionSTKP-R 5’-TTGATTATGAATTCGCTTTTAAGGAGTAGC-3’ EcoRI stkP expressionSTKP-RT 5’-GTAGGACAGAATTCAAGACAAGTCTACATACA-3’ EcoRI stkP ... 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacementPRTI 5’-CAATTGACCAGCCTTGAGCA-3’ phpP RT-PCRPRT-F 5’-ATAGCACCTGCACTATCGTCT-3’ phpP RT-PCRPRT-R 5’-CGCTCGTCAACTGATGGTATT-3’ phpP RT-PCRSX 5’-GAACAATTCCTCGAGTATGG-3’...
  • 12
  • 466
  • 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... (Val-Val-Tyr-Pro-Trp) was a gift from K. Fukasawa (Matsu-moto Dental University, Nagano, Japan). The anti-(rat liverDPP III) was prepared as described by Fukasawa et al.[2].Goat anti-rabbit ... Characterization of a functionally expressed dipeptidylaminopeptidase III from Drosophila melanogasterClaire Mazzocco1,*, Kayoko M. Fukasawa2, Patrick Auguste3and Jacques Puiroux1,†1Laboratoire ... firstidentification and characterization of an insect DPP III thatplays a major role in proctolin degradation.Experimental proceduresMaterialsDiaminobenzidine (DAB), Hepes, hydrogen peroxide,enkephalins,...
  • 9
  • 357
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ