Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

... representation of the interpretation of logical metonymy and a more thorough evaluation methodthan that of Lapata and Lascarides (2003).By carrying out a human experiment weprove that such a representation ... byLapata and Lascarides (2003) used text corpora toautomatically derive interpretations of metonymicphrases.1Utiyama et al. (2000) used a statistical modelfor the interpretation of general ... in natural language texts and it is a serious bottleneck in automatic text un-derstanding. We address the problem of interpretation of logical metonymy, using a statistical method. Our approach...

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢ﬁ3¢)CorrespondingpeptideAS1 GGTTGCCTGAGRTGYATHTG a GCLRCICAS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATLAS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATLAS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTHanalyser.Synthesis of cDNATotal RNA was extracted using the RNeasy Mini Kit(Qiagen) according to the manufacturer’s instructions. Itwas treated with RNAase-free DNAase I (Pharmacia) ... putative models of its secondary andtertiary structure.Material and methodsBiological materialThe starﬁsh A. rubens was collected near Roscoff (Brittany,France). For RNA extraction, samples...

Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf

... 1).2.2 Clark and Curran (2009)Clark and Curran (2009), hereafter C&C-CONV, as-sign a schema to each leaf (lexical category) and rule(pair of combining categories) in the CCG derivation.The ... parameters. Our approach leads to in-creases on all metrics of at least 1.1%, and increasesexact sentence match by over 11% (both absolute).Many of the remaining errors relate to missingand ... requiringschemas for all valid pairs of categories — at a minimum, the 2853 unique category combinationsfound in CCGbank. Clark and Curran (2009) createschemas for only 776 of these, handling the remain-der...

Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

... effective algorithm for the classification task. Turney and Littman (2005) achieve an accuracy of 45.7%, where we achieve a maximum accuracy of 38.1% on this dataset using a nearest neighbor algorithm. ... this is that dividing a set of 600 in-stances into 30 classes results in a fairly sparse and uneven dataset. Table 1 is a list of the relations used and examples of compounds that are labeled ... noun phrases se-mantic relations. Over the set of 5 semantic rela-tions defined by Nastase and Szpakowicz (2003), they achieve an accuracy of 45.7% for the task of assigning one of 5 semantic...

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic ... models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger conventional...

Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

... ABSTRACT FOCUSING AND ANAPHORA RESOLUTION Novice users engaged in task-oriented dialogues with an adviser to learn how to use an unfamiliar statistical package. The users', task was ... and an analysis of the users' and adviser's plans and goals. BOUNDARY MARKERS The analysis of boundary markers revealed reliable indicators at the opening of subdialogues in adviser-user ... words and phrases occurring at the boundaries of the subdialogues and mapped the distribution of the antecedents of pronominal and non-pronominal anaphors. ANALYSIS OF THE DIALOGUES ANALYSIS OF...

Tài liệu Báo cáo khoa học: "Some Uses of Higher-Order Logic in Computational Linguistics" pdf

... H(Ax P) and 3x P is an abbreviation for G(Ax P). H and E are examples of what are often called generalized quantifiers. The type o has a special role in this language. A formula with a ... such analyses in one computational framework. A common approach in natural language understanding systems is to use one computational paradigm for syntactic analysis (e.g. DCGs, ATNs) and another ... simple parser of natural language can be smoothly integrated into one logical and computational process. We shall first present a defi- nite clause grammar that analyses the syntactic structure...

Tài liệu Báo cáo khoa học: "The Role Of Focussing in Interpretation of Pronouns " pdf

... concept of antecedence is defined computationally as a relationship among elements represented in a database. Using this framework, the paper supports two claims by means of rules for antecedence. ... inference. The paper also indicates what additional requirements are needed for a full treatment of pronominal anphora. These include use of a representation such as that of Webber [197g]; ... path is taken. In addition, Winograd and Lockman are aware of pronopn phenomena which cannot be treated strictly by inference, as shown below. D2-1 I haven't seen Jeff for several days....

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... lyase pathway). Bottom: cleavage toyield AMPA and glyoxylate (the AMPApathway), referred to as the GOX pathway.(B) Reaction catalyzed by GO on glyphosate,an alternative to the AMPA pathway ... glyphosate cannotbe regarded a mere analog of PEP, but it ratherappears to mimic an intermediate state of PEP, pre-sumably that of the elusive carbocation. More than1000 analogs of glyphosate have ... different from that of GOX.OxidasesGOX (Monsanto)Early on, Monsanto Co. isolated glyphosate-AMPAbacteria from a glyphosate waste stream treatmentfacility. Achromobacter sp. LBAA was thus identiﬁedfor...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... Pervandate and catalase wereprepared as described previously [25]. Brieﬂy, vanadatestock solution was prepared as a 200 mM solution of sodium orthovanadate (pH 10). Pervanadate was preparedas ... blotting of lysates from pervanadate-treatedcells with an antibody against total tau revealeddecreased electrophoretic mobility of tau, with theappearance of an  68-kDa tau species in wild-type andall ... increasedamount of tau bound to Fyn-SH2, as compared withcells treated with catalase (Fig. 1A) . Furthermore, a tau species of  68 kDa was apparent in SH2 pull-downs from pervanadate-treated...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM