Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... The Authors Journal compilation ª 2006 FEBS DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner Hana Pivonˇkova´1, ... modification with the antitumor drug cisplatin inhibits p53 binding to a synthetic p53 DNA- binding site. Here we demonstratethat the effects of global DNA modification with cisplatin on binding of the p53 ... theinhibition of the p53 sequence-specific DNA binding to these targets caused by the DNA treatment with cisplatin. ABFig. 3. Effects of DNA modification with cisplatin on p53( 1–363) binding...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: An allosteric DNAzyme with dual RNA-cleaving and DNA-cleaving activities doc
... RNA-cleaving activity in a self-cleaving DNAzyme. The DNAzyme with DNA- cleaving and RNA-cleaving activities was constructedby incorporating the catalytic domain of 8–17 variantDNAzyme into the ... insightsinto the engineering of DNAzymes.Experimental proceduresMaterialsThe DNA sequences (PL DNAzyme, 5¢-GAATTCTAATACGACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢;8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCGGGCCTC-3¢; ... RNA-cleaving activity of DRc DNAzyme was assayed at A BCDFig. 2. The DNA- cleaving activity and cleavage sites of DRc DNAzyme. (A) 5¢-32P-labeled DRc DNAzyme was incubated in buffer A at 23 °Cwith...
- 7
- 601
- 0
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx
... the range of 5–10 kDa, typically including two dominating peaksat approximately m ⁄ z 7000. As mycelia and sporeslargely remained intact, and the extraction solutioncontained acetonitrile and ... and 7521 appearing (Fig. 4B). To obtain a preliminarycorrelation of observed masses with hydrophobindata, we again calculated from the available sequencedata sets of masses for each hydrophobin, ... hydrophobins led to the identification of anHFB1-like protein, which, after N-terminal processing(MKFFTAAALFAAVAIA), C-terminal processing(AVGA) and disulfide bond formation, has a mass of 7743 Da.T....
- 12
- 632
- 0
Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx
... peptides are involved in a variety of neuronal and endocrine functions, including regula-tion of appetite and circadian rhythm, as well ascardiovascular, reproductive and gastrointestinal func-tions ... 2048–2063 ª 2006 The Authors Journal compilation ª 2006 FEBS 2059used: forward primer 5¢- CAATTGGGAAGAAAACCAGACA and reverse primer 5¢- GCACAATGTATTCACCAGCAGA. Actin, used as a positive control ... analysis of Y2 and Y7gene expression, actin was amplified usingforward primer 5¢-AATCAAGATCATTGCCCCAC and reverse primer 5¢-TAAGACTGCTGCTGACACC. PCRwas performed using Roche Taq polymerase in PCR...
- 16
- 580
- 0
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc
... the thin layer chromatography plates,the metabolites were quantified by scraping the radioactiveareas and counting with a Wallac 1410 counter.Substrate-induced binding spectraSpectral titrations ... DDT.Substrate binding The substrate induced binding spectra associated to DDT and to testosterone are type I spectra (data not shown) and Fig. 1. Production of the CYP 6A2 variants in bacteria. The lanes ... protein was affected by each of the mutationsTable 4. Apparent a nity of DDT and testosterone for CYP 6A2 wt and CYP 6A2 vSVL. For each apparent a nity calculated, the mean ± SD and the number of...
- 8
- 535
- 0
Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc
... ACL.Karolina Owczarzak, Josef van Genabith, and Andy Way.2007. Labelled dependencies in machine translationevaluation. In Proceedings of the Second Workshopon Statistical Machine Translation.Sebastian ... L. Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In AMTA.Valentin I. Spitkovsky, Hiyan Alshawi, and Daniel Juraf-sky. 2011. Lateen em: Unsupervised ... Association for Computational LinguisticsLearning to Translate with Multiple ObjectivesKevin Duh∗Katsuhito Sudoh Xianchao Wu Hajime Tsukada Masaaki NagataNTT Communication Science Laboratories2-4...
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: Tet repressor mutants with altered effector binding and allostery docx
... binding revealed decreased affinities and positive cooperativity. Thus, mutations in this interface can in uence DNA binding as well as effector binding, albeitboth ligand binding sites are not in direct ... isincreased, leading to loss of DNA binding. Helices a1 , a4 and a6 forming this interface are involved in signaltransduction, but there is no structural hint for an in uence on effector binding. ... mutated parts of helices a1 , a4 anda6(see arrows) forming the interface between the DNA- binding head and the protein core are highlighted in red in one subunit. (B) Over-lay of the induced (dark...
- 10
- 527
- 0
Tài liệu Báo cáo khoa học: "Transition-based parsing with Confidence-Weighted Classification" pdf
... iterations. Table 1 compares trainingtime (10 iterations) and parsing time of a parserusing a CW-classifiers and a parser using SVM onthe same data set. We see that training of the CW-classifier ... results have been ob-tained using margin-based machine learning ap-proaches. For the MST-parsing MIRA (McDonaldet al., 200 5a; McDonald and Pereira, 2006) and fortransition-based parsing Support-Vector ... confidence-weightedclassification in transition-based parsinggives results comparable to using SVMs with faster training and parsing time. Wealso compare with other online learningalgorithms and investigate the...
- 6
- 493
- 0
Tài liệu Báo cáo khoa học: "K-means Clustering with Feature Hashing" docx
... Eliminating alphabet storage In this kind of hashing tricks, an index of inputsdo not have to be an integer but can be any hash-able value, including a string. Ganchev and Dredze(2008) argued this property ... 2003;Boutsidis et al., 2010), feature hashing retains spar-sity of sparse input vectors. An additional usefultrait for NLP tasks is that it can save much memoryby eliminating an alphabet storage (see ... is vital to know theexpectation and variance of the sum of squared hashlengths. Because the variance of the sum of ran-dom variables derives from each covariance betweenpairs of variables,...
- 5
- 601
- 0
Tài liệu Báo cáo khoa học: "Answering Opinion Questions with Random Walks on Graphs" docx
... GraphsFangtao Li, Yang Tang, Minlie Huang, and Xiaoyan ZhuState Key Laboratory on Intelligent Technology and SystemsTsinghua National Laboratory for Information Science and TechnologyDepartment ... the topic score and the opinion score areusually separately calculated and then combinedvia a linear combination (Varma et al., 2008) orjust filter out the candidate without matching thequestion ... (Stoyanov etal., 2005) first created an opinion QA corpusOpQA. They find that opinion QA is a more chal-lenging task than factual question answering, and they point out that traditional fact-based...
- 9
- 420
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ