4 12 stripes of labeled cells travel toward the tip vertical stripes of labeled cells show the location of stem cells and their paths of migration to the ridge images a b c d e and f are the same frame but from sequential z stacks β ac
The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation
... GGAGCCTTTGATTTCCCCCT 60 Hcp1Dn3 GAAATCAAAGGCTCCGCGGGCGCCGCAAACTGG AC 60 Hcp1FH GGCCAGTGCCAAGCTTGCAGATCGTCGTGTCGGA 60 Hcp1RB CGGTACCCGGGGATCCGATCAGCCATTCGTCCAG T 60 TssCRB CGGTACCCGGGGATCCGCGCTTCAGGAAATCGTT ... CGGTACCCGGGGATCCGCGCTTCAGGAAATCGTT 60 Hcp1Q46AE47AF GCGGCGGGCCTGACGCCCGCCGCCGCCGCTCGC 60 Hcp1Q46AE47AR CGTCAGGCCCGCCGCGAGCCTGGCAGGCATGTC 60 Hcp1L49AT50AF CAGGAAGGCGCGGCGCCCGCCGCCGCCGCTCGC 60 Hcp1L49AT50AR CGCCGCGCCTTCCTGGAGCCTGGCAGGCATGTC ... CGCCGCGCCTTCCTGGAGCCTGGCAGGCATGTC 60 Abbreviations: Ta,, annealing temperature 23 Chapter Materials and < /b> Methods Primer (realtime PCR) Gene CACATCCTCGCCTTCAA TCTCGAACTCTTCCATCATCT GTTCCATCGTTCACCAAGTG...
- 155
- 1,103
- 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx
... activity Chemotactic ability of < /b> MIP- 1a < /b> toward < /b> activated macrophages A < /b> difference in the < /b> chemotactic ability of < /b> MIP- 1a < /b> for different activated MF was verified This difference was reflected in two ways ... the < /b> forward primer for MIP- 1a < /b> was CTCCCAGCCAGGTGTCATT, and < /b> the < /b> reverse primer was GGCATTCAGTTCCAGGTCAG The < /b> forward primer for b- actin was CCGTGAAAAGATGACCCAG, and < /b> the < /b> reverse primer was TAGCCACGCTCGGTCAGG ... states of < /b> MF Different activated MF in RPI are induced by distinct cytokines generated by damaged cells < /b> after g-ray irradiation of < /b> the < /b> lung Classical activation of < /b> macrophages was originally reported...
- 7
- 380
- 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf
... sequences of < /b> the < /b> COX-2 (M64291) primers were: 5¢CCAGCAAAGCCTAGAGCAAC-3¢ (forward primer) and < /b> (5¢-AGCACAAAACCAGGATCAGG-3¢) reverse primer To < /b> detect the < /b> PCR efficiency for each couple of < /b> primers, an amplification ... suggested an active role for AA as a < /b> cofactor involved in the < /b> early stages of < /b> quartz-induced pathology, and < /b> they represent the < /b> basis of < /b> the < /b> present study on the < /b> effect of < /b> AA on the < /b> quartz-induced ... instructions Band detection and < /b> densitometry were performed using the < /b> Chemi-Doc System and < /b> the < /b> quantity one software package (Bio-Rad) The < /b> PGE2 concentration in the < /b> culture medium from cells < /b> incubated for...
- 14
- 253
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... of < /b> each kidney was fixed in 2% glutaraldehyde/PBS and < /b> these were then embedded and < /b> processed for electron microscopy The < /b> electron microscopic sections were then analysed and < /b> photographed by a < /b> ... 33.H11VL, and < /b> UK-4VL regions are numbered according to < /b> the < /b> system of < /b> Wu and < /b> Kabat [26] Amino acids are indicated by their < /b> one-letter code Dots have been inserted to < /b> facilitate the < /b> alignment A < /b> dash indicates ... hour at 37 C, followed by the < /b> addition of < /b> ethylenediaminetetraacetic acid (EDTA) to < /b> a < /b> final concentration of < /b> 15 mM The < /b> supernatants were then assayed to < /b> determine the < /b> concentration of < /b> whole antibody...
- 13
- 472
- 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf
... the < /b> change in the < /b> WOMAC pain score from day to < /b> week in patients administered AMG 108 compared to < /b> placebo Assuming an effect size of < /b> 0.60 (ie, the < /b> expected difference in means between the < /b> placebo ... Cmax increased 8.2-fold and < /b> AUC0-τ increased 17.3-fold for a < /b> 4-fold dose increase (Table 3) Because of < /b> the < /b> non-linear nature of < /b> the < /b> PK data and < /b> insufficient data for the < /b> terminal phase of < /b> the < /b> concentration-time ... Statistical analysis Patient data were analyzed according to < /b> randomized treatment arm regardless of < /b> actual treatment received during the < /b> study The < /b> safety dataset included all patients who received...
- 30
- 277
- 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf
... set and < /b> the < /b> model-reduction procedure is repeated Additional details are provided in Additional data file Matlab code and < /b> the < /b> data can be obtained upon request Additional data files The < /b> following ... coefficients of < /b> the < /b> different measured pathways activated by TLR ligand may have been overestimated in trying to < /b> fit the < /b> specific LPS effect The < /b> negative coefficients of < /b> PAF for G-CSF and < /b> TNFα ... double-ligand screen experimental data were obtained from the < /b> AfCS Data Center [9] To < /b> generate these data, RAW 264.7 macrophages were stimulated with a < /b> variety of < /b> receptor-specific ligands applied...
- 14
- 182
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... of < /b> e1 and < /b> e and < /b> approximately the < /b> same slope of < /b> the < /b> k1 and < /b> k (Fig 3) suggeststhatthenatureofthefirstkineticphaseofthereaction between Yb3+ and < /b> apo-Tf is the < /b> same as that of < /b> the < /b> reaction between ... loaded into the < /b> C- lobe (FeC-Tf) was prepared and < /b> the < /b> binding kinetics of < /b> Yb3+ to < /b> FeC-Tf was studied under the < /b> same experimental conditions Quite differently, the < /b> kinetic data for the < /b> reaction of < /b> ... represent the < /b> location < /b> and < /b> relative concentration of < /b> the < /b> labeled < /b> Yb-Tf The < /b> red fluorescence resulted from the < /b> emission of < /b> propidium iodide when the < /b> same cells < /b> were labeled < /b> with propidium iodide...
- 9
- 385
- 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... CD6 6b mAb, and < /b> CD6 6c mAb (panel B) , the < /b> CD66ae mAb, CD6 6b mAb, and < /b> CD66de mAb (panel C) , the < /b> CD66ae mAb, CD6 6c mAb, and < /b> CD66de mAb (panel D) , or the < /b> CD6 6b mAb, CD6 6c mAb, and < /b> CD66de mAb (panel E) , ... Ca2+ free buffer containing IgG (panel A)< /b> , the < /b> CD66ae mAb and < /b> CD6 6b mAb (panel B) , the < /b> CD66ae mAb and < /b> CD6 6c mAb (panel C) , the < /b> CD66ae mAb and < /b> CD66de mAb (panel D) , the < /b> CD6 6b mAb and < /b> CD6 6c mAb ... family members expressed on neutrophils, CEACAM1, CEACAM8, CEACAM6, and < /b> CEACAM3 (recognized by CD6 6a,< /b> CD6 6b, CD6 6c, and < /b> CD6 6d mAbs, respectively) have been shown to < /b> be capable of < /b> activating neutrophils...
- 12
- 599
- 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
... migration < /b> of < /b> CD8 and < /b> CD4 T cells < /b> through an in vitro BBB model HBECs were plated to < /b> the < /b> upper chamber of < /b> a < /b> Boyden chamber and < /b> then inflamed Activated CD8 (A,< /b> B) and < /b> CD4 (C, D) T cells < /b> were added ... the < /b> wells for the < /b> entire co-culture After a < /b> day co-culture, CD8 T cells < /b> were collected and < /b> stained for Live/dead fixable Aqua dead cell stain kit (Invitrogen) to < /b> exclude dead cells < /b> and < /b> stained ... and < /b> NA hold Donald Paty Career Development Awards from the < /b> MSSC and < /b> are Research Scholars from the < /b> Fonds de la Recherche en Page 11 of < /b> 12 < /b> Santé du Québec The < /b> authors are grateful for the < /b> technical...
- 12
- 294
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... CD34+ cells < /b> FACS analysis of < /b> differentiating DCs from hES and < /b> FL CD34+ cells:< /b> CD34+ cells < /b> were cultured in cytokine media and < /b> analyzed by FACS for CD14 and < /b> CD 1a < /b> markers at different days by staining ... marker The < /b> cells < /b> were then incubated with Alexa-Dextran at 0 C and < /b> 37 C for hr and < /b> analyzed by FACS as described in Methods The < /b> percent antigen uptake was measured as the < /b> difference in percentages ... differentiated from hES and < /b> FL derived CD34+ cells < /b> were stained with CD 1a < /b> and < /b> HLA-DR, CD 1a < /b> and < /b> B7 .1, and < /b> CD 1a < /b> and < /b> B7 .2 Results showed that hES derived DCs are positive for HLA-DR, B7 .1, and < /b> B7 .2...
- 9
- 261
- 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn
... Ignition System Hệ thống đánh l a < /b> tr c tiếp DOHC Double overhead camshafl Tr c cam kép đặt EFI Electronic Fuel injection Hệ thống phun xăng điện tử M/T Mechaniccal transmission Hộp số thường MAX Maximum ... lượng d u B c tr c khuỷu hỏng B c truyền hỏng L c d u t c Van tràn hỏng 35 Kh c ph c S a < /b> ch a < /b> Thay phớt d u Thay gioăng S a < /b> ch a < /b> S a < /b> van d u S a < /b> b m d u Thay d u Thay b c Thay b c Thay l c d u S a < /b> ... c n b sung TRUYỀN ĐỘNG, TREO, LÁI, PHANH ABS Anti –lock Brake System Hệ thống phanh chống b c ng ATF Automatic Transmission Fluid D u hộp số tự động HOT Hot Nóng COOL Cool Mát EBD Electronic Brake...
- 118
- 4,276
- 54
8 cách đơn giản tăng tốc windows 7
... đến c ng vi c b n: ASP.NET State Service, Automatic Updates, Help and < /b> Support, Indexing Service, Messenger, Remote Registry, Upload Manager, Web Client, Machine Debug Manager Chỉnh s a < /b> File boot.ini ... động nhanh hơn: - Vào menu Tools Windows Explorer > Folder Option Qua thẻ View, chọn Hidden files and < /b> folder b chọn m c Do not show < /b> hidden file and < /b> folder Hide protected operating system files, ... b n mở khoá sau: HKEY_LOCAL_MACHINE \SOFTWARE \Microsoft \Dfrg \BootOptimizeFunction B n nhìn qua c a < /b> sổ b n phải, double click vào biểu tượng Enable Trong khung Value Data, b n thay đổi giá trị...
- 19
- 440
- 0
cac nguyen to thuoc nhom 7
... không b n, d phân huỷ + Trong không khí ẩm : 2CaCl(OCl) + CO2 + H2O = CaCO3 + CaCl2 + 2HClO + T c d ng với HCl: CaOCl2 + 2HCl = CaCl2 + Cl2 + H2O + B ánh sáng t c d ng mạnh: 2CaOCl2 = 2CaCl2 ... HALOGEN Nư c Javen dung d ch nư c NaCl + NaClO tạo nên cho khí Cl2 phản ứng với dung d ch NaOH nguội: Cl2 + 2NaOH nguội = NaCl + NaClO + H2O Trong c ng nghiệp, nư c Javen điều chế điện phân dung ... dung d ch NaCl 15 - 20% màng ngăn với điện c c âm Fe, điện c c d ơng Ti: NaCl + H2O đp NaClO + H2↑ Khí H2 thoát khỏi b điện phân, thu nư c Javen: NaCl + NaClO + H230 O HỢP CHẤT HALOGEN Clorua vôi...
- 45
- 754
- 2
Essential guide to writing part 7
... intuitive, a < /b> well-made paragraph uses sentences to < /b> analyze the < /b> subject For Practice > Selecting one of < /b> the < /b> general subjects listed below, compose ten topic sentences, each on a < /b> different aspect of < /b> the < /b> ... sentences, and < /b> the < /b> close of < /b> one sentence and < /b> the < /b> opening of < /b> the < /b> one immediately following (the < /b> italics are added in the < /b> following examples): No man of < /b> note was ever further separated from life and < /b> ... sentences of < /b> a < /b> good expository paragraph reflect a < /b> clear, rational analysis of < /b> the < /b> topic Here is a < /b> brief example, this one by Bertrand Russell (The < /b> sentences have been numbered for convenience.)...
- 15
- 371
- 0
British English A to Z - past 7
... the < /b> over, the < /b> result is called a < /b> maiden over, and < /b> the < /b> bowler is said to < /b> have bowled a < /b> maiden over Metaphorically maiden over can be used as an elegant and < /b> dramatic way of < /b> describing any achievement ... the < /b> near-side lane refers to < /b> the < /b> leftmost one for regular driving The < /b> one nearest the < /b> center is called the < /b> off-side lane, and < /b> is used for passing The < /b> terms near-side and < /b> off-side can also refer ... and < /b> touches another (called bumping) scores a < /b> win A < /b> bump-supper is held to < /b> celebrate four wins maze, v.t bewilder MB, abbrev Bachelor of < /b> Medicine In Britain, the < /b> degree needed to < /b> practice medicine...
- 29
- 443
- 0
Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7
... Vẽ hình viết giải thiết, kết luận đúng: 0.5đ a)< /b> Chứng minh đ c tam gi c ABC = tam gi c ADE 0.75đ b) Chứng minh đ c DE//BC c) Chứng minh đ c AF =AC CFEF 0.75đ 0.5đ ... h c kỳ I môn to< /b> n - lớp Thời gian làm b i: 90 phút C u 1: Mỗi c u trả lời đ c 0.25đ c u đáp án Đ S đ s C u 2: Mỗi ý đ c 0.25đ c u a < /b> b c d đáp án a < /b> c d b Tự luận: THPT: Mỗi c u 0.5đ a < /b> 20 b -36 c ... b -36 c Tìm x: Mỗi c u 0.5đ a < /b> x= 28 b x=9 c x= 16 x= Gọi ẩn viết đ c tỷ lệ th c: 1đ - áp d ng tính chất d y tỉ số c kết đúng: 1đ + Lớp 7A:< /b> 3 5c y + Lớp 7B: 25 + Lớp 7C: 1 5c y Vẽ hình viết giải...
- 2
- 447
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
... consultancies are invited by a < /b> prospective client to < /b> propose how they would tackle a < /b> given brief • Press Pack/Kit: a < /b> branded pack handed out to < /b> the < /b> media by an organisation It normally contains background ... TV broadcast about a < /b> client • Vertical < /b> media: media relating to < /b> different market sectors for a < /b> product or service For example, you can promote a < /b> barcode printer in the < /b> printing media, packaging ... packaging media and < /b> food retailing media • Viral campaign: a < /b> communications campaign which is designed to < /b> exploit the < /b> potential of < /b> the < /b> internet to < /b> spread messages rapidly The < /b> audience is encouraged to...
- 2
- 490
- 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt
... sau vào Windows Explorer m c Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu b n c dropbox Favorites, phải chuột vào folder chuyển tới folder Send To < /b> Khi b n d n folder này, b n di ... C: \Documents and < /b> Settings\[User Name]\SendTo (User Name tên máy tính b n) tạo shortcut cho folder Dropbox Giờ b n c folder Dropbox thêm vào m c Send To < /b> Menu Context Nếu b n sử d ng Send To < /b> menu Context, ... ví d , thêm folder Dropbox chia sẻ Thêm Dropbox vào Send To < /b> hệ điều hành XP Trong hệ điều hành Windows XP, vào Control Panel > Folder Options > Show < /b> hidden files and < /b> folders Chuyển tới C: \Documents...
- 8
- 385
- 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx
... Use Of < /b> Scribe by PC candidates: The < /b> visually impaired candidates and < /b> candidates whose writing speed is affected by cerebral palsy can use their < /b> own scribe at their < /b> cost during the < /b> written examination ... the < /b> response of < /b> the < /b> candidates, administrative feasibility, etc The < /b> date of < /b> the < /b> test is tentative The < /b> exact date/centre/venue of < /b> examination will be communicated to < /b> the < /b> candidates through the < /b> call ... Name & Code Number of < /b> the < /b> branch selected for payment (iv) Date of < /b> Payment and < /b> (v) Fee to < /b> be paid After payment, the < /b> candidate must ensure that the < /b> transaction ID generated is entered into the...
- 17
- 347
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25