you can use makecircle as you do any other method of a movie clip the top statement creates a circle at x 200 y 300 with a radius of 100 and an outline 2 points thick the bottom statement creates a circle at x 200 y 150 with a rad

The Classification of Pulmonary Tuberculosis and An Outline of Standardised Principles of Management pot

The Classification of Pulmonary Tuberculosis and An Outline of Standardised Principles of Management pot

Ngày tải lên : 06/03/2014, 04:20
... localisations of the first lesion of primary and that of secondary disease In explanation of the localisation of the first lesion of primary disease in the absence of acquired resistance and hypersensitivity, ... cases of bilateral fibro-caseous disease showed that of 87 cases in which collapse therapy was performed, it was unilateral and almost invariably against the initial lesion in 34 and was bilateral ... ‘complete diagnosis’ is made on the basis of type and form of the disease as well as extent and activity, then management can be prescribed with a feeling of satisfaction by any practitioner It...
  • 14
  • 497
  • 0
Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc

Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc

Ngày tải lên : 09/08/2014, 22:23
... GGTTTTAACCGCATACGCAAAGGAGAAATGCAAGGCATTGCTTGAAGAGCCGTTTGGGAGGATTGTAGAAATGGTAGGAGAAGGGTCAAAGAGGATAACGGATGAGTATGCGCGGTCTGCTATAGATTGGGGA A G T T .A .T T .A G A A T G A G A G C A G T T .A .T T .A G A A T G A ... G A T.T G T GCAGTTTTAACTGCTTACGCAAAGGCGAAATGCAAGGCATTGCTTGAAGAGCCGTTTGGGAGGATTGTGGAAATAGTAGGTGATGGGGCAAATAGGATAACGGATGAGTATGCGCGGTCTGCTATAGATTGGGGA Mapped to Aa ortholog GGTTTTAACCGCATACGCAAAGGAGAAATGCAAGGCATTGCTTGAAGAGCCGTTTGGGAGGATTGTAGAAATGGTAGGAGAAGGGTCAAAGAGGATAACGGATGAGTATGCGCGGTCTGCTATAGATTGGGGA ... between Aa1 and Aa2 proteins [48] In F 1As, along with the parental dimers At1 -At2 and Aa1-Aa2, there will also be heterologous At1 -Aa2 and Aa1 -At2 dimers Are these dimers likely to be functional [48]?...
  • 17
  • 336
  • 0
42 TELESALES TIPS YOU CAN USE RIGHT NOW TO GET MORE BUSINESS AND AVOID REJECTION

42 TELESALES TIPS YOU CAN USE RIGHT NOW TO GET MORE BUSINESS AND AVOID REJECTION

Ngày tải lên : 20/10/2013, 06:15
... sending material, prepare them as to what they should look for Otherwise, they'll get a package of materials and say, "Oh, there's a package of materials," and then toss it on the mountain of other ... your call than they were before it, even if they didn't buy anything Call with news they'll have an interest in; ideas you' ve heard from other customers they might be able to take advantage of; ... on each call, and you can hold your head high with a sense of achievement Remember, a decision of any type is better than shadow-chasing someone who will waste your time with wimpy or misleading...
  • 14
  • 856
  • 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

Ngày tải lên : 01/06/2014, 10:54
... Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary specialty This will appear on your transcript when you graduate ... personal essay allows each applicant to help admission officers read the map more accurately In addition to speaking of your goals, dreams, and expectations, you can explain any gaps or changes ... Pharmacology, Human and Animal Biophysics Physiology, Human and Animal Botany, General Plant Pathology Cell Biology Plant Pharmacology Ecology Plant Physiology Embryology Predentistry Entomology Premed...
  • 142
  • 375
  • 0
Cartoon Clouds You Can Use docx

Cartoon Clouds You Can Use docx

Ngày tải lên : 28/06/2014, 20:20
... drawing like this it's good to keep in mind that you want to keep them as simple and clean as possible Example - Another Decorative Cloud These clouds are drawn the same way as the ones in the ... draw it for yourself I started with the outline and then later went back and made some of the outer lines thicker Notice that the lines become thicker as they get near the bottom Overall when you' re ... first saw clouds like this in the video game Zelda: The Wind Walker and I thought that they were really cool Actually the entire style of the game is totally awesome and if you haven't played this...
  • 4
  • 304
  • 0
402Part II: SQL and SQL*PlusWithin the into table clause, you can use the recnum keyword to pps

402Part II: SQL and SQL*PlusWithin the into table clause, you can use the recnum keyword to pps

Ngày tải lên : 07/08/2014, 14:20
... remote database via a database link The account that the database link uses in the remote database must have access to the tables and views used by the database link You cannot create a materialized ... If you are a user in the Local database shown in Figure 22 -1, you can access objects in the Remote database via a database link To this, simply append the database link name to the name of any ... in your schema to support your text queries You can rebuild your text index via the alter index command, just as you would for any other index As of Oracle9i, you can use a CTXCAT index type...
  • 105
  • 472
  • 0
Office VBA Macros You Can Use Today phần 1 docx

Office VBA Macros You Can Use Today phần 1 docx

Ngày tải lên : 14/08/2014, 09:21
... figures the database is “everything If you have data, then you have a reason to create an application to manage this data.” Under the moniker “smozgur”, Suat has contributed to many technical forums, ... section, there are three variables that you can change: Path: where the file will be saved DateFormat: the format to use for the file name page 22 Office VBA: Macros You Can Use Today Excel Procedures ... (Basic Office VBA: Macros You Can Use Today page e About the Authors and Contributors was way too slow for a lot of tasks he had in mind) After an upgrade to the Amiga 20 00 , Nico had to buy an IBM...
  • 46
  • 363
  • 0
Office VBA Macros You Can Use Today phần 2 ppsx

Office VBA Macros You Can Use Today phần 2 ppsx

Ngày tải lên : 14/08/2014, 09:21
... CountIfColor(ByVal Range As Range, _¶ ByVal criteriaColor As Range) As Variant¶ 'Variable declaration¶ Dim Rng As Range¶ 'Make it volatile - automatic calculation¶ Application.Volatile True¶ 'Validations, ... SumIfColor(ByVal Range As Range, _¶ ByVal criteriaColor As Range, _¶ Optional ByVal sum_range As Range) As Variant¶ 'Variable declaration¶ Dim i As Long¶ 'Make it volatile¶ Application.Volatile True¶ 'Validations, ... update the data and to create charts or other reports that must be sent to people outside of the company, but your company policy does not permit revealing how data was calculated This macro creates...
  • 45
  • 359
  • 0
Office VBA Macros You Can Use Today phần 3 ppt

Office VBA Macros You Can Use Today phần 3 ppt

Ngày tải lên : 14/08/2014, 09:21
... Almost all applications can create a text file that can be imported into another application so that application can use the information to some other purpose In almost every case, there is a need ... Office VBA: Macros You Can Use Today page 93 Excel Procedures Exl 'Make sure that there is a trailing backslash¶ If Right$(Path, Len(Application.PathSeparator)) _¶ Application.PathSeparator Then¶ ... reference to the database (using an Excel database)¶ Set PivotData = Range(Application.ConvertFormula( _¶ Pivot.SourceData, xlR1C1, xlA1))¶ 'Create a new PowerPoint presentation (and application)¶...
  • 45
  • 325
  • 0
Office VBA Macros You Can Use Today phần 4 pot

Office VBA Macros You Can Use Today phần 4 pot

Ngày tải lên : 14/08/2014, 09:21
... for the presence of the entire formula that is added to the list; for example, (A2 * A3 ) Only those parts of the formula that exactly match will be changed Any other parts of the formula containing ... weekDay(dat)¶ 'Calculate the number of days in the specified month¶ nrDays = DateDiff("d", dat, DateAdd("m", 1, dat))¶ monthName = Format(dat, "MMMM") & " " & _¶ Format(dat, "yyyy")¶ 'Start in the ... your software manual was developed using many levels of AutonNumbering When you copy and paste as unformatted text, or save as a TXT file, the numbering is lost Wrd Example file: W010 This macro...
  • 45
  • 328
  • 0
Office VBA Macros You Can Use Today phần 5 ppsx

Office VBA Macros You Can Use Today phần 5 ppsx

Ngày tải lên : 14/08/2014, 09:21
... for mail merge were added and page 20 6 Office VBA: Macros You Can Use Today Word Procedures these offer an alternate path that makes it comparatively easy for a user to set up the main merge document, ... BeforeMergeExecuted As Boolean¶ Public CancelMerge As Boolean¶ Public recordIndex As Long¶ Private DatabasePath As String¶ Private FieldNames() As Variant¶ Private TableName As String¶ Private sepChar As String¶ ... that password at the top of the macro module, such as: Const password as String = "password")¶ Changing Other Types of Formatting As mentioned, this tool can be expanded to include other types...
  • 45
  • 240
  • 0
Office VBA Macros You Can Use Today phần 6 doc

Office VBA Macros You Can Use Today phần 6 doc

Ngày tải lên : 14/08/2014, 09:22
... Variant) As String¶ Select Case varLang¶ Case 0¶ LanguageIDText = "All languages"¶ Case 20 55¶ LanguageIDText = "German (Swiss)"¶ Case 1031¶ LanguageIDText = "German (Germany)"¶ Case 3079¶ LanguageIDText ... that correspond to company standards and corporate identity Even better is a template that gathers all the standard information in a single interface and takes the task of inserting it into the ... Because it simply fills the datasheet of an MS Graph object that is inserted and formatted, the macro solution can be used with any kind of chart Follow these steps: Save the data document and...
  • 45
  • 277
  • 0
Office VBA Macros You Can Use Today phần 7 pdf

Office VBA Macros You Can Use Today phần 7 pdf

Ngày tải lên : 14/08/2014, 09:22
... database Adding or modifying a record in the database form will help manage related Task Items in Outlook by using database form events Scenario: The sample database is an Order Entry database ... Object¶ 'Database format¶ Dim intVer As Integer¶ 'Create ADODB Catalog object¶ 'to create a new database file¶ Set objDB = CreateObject("ADOX.Catalog")¶ intVer = 'Access 20 00 database file format¶ ... InternetOpen Lib "wininet" _¶ Alias "InternetOpenA" (ByVal sAgent As String, _¶ ByVal lAccessType As Long, _¶ ByVal sProxyName As String, _¶ ByVal sProxyBypass As String, _¶ ByVal lFlags As Long) As...
  • 45
  • 434
  • 0
Office VBA Macros You Can Use Today phần 8 docx

Office VBA Macros You Can Use Today phần 8 docx

Ngày tải lên : 14/08/2014, 09:22
... shapes can be drawn on slides where they may be used, and then manually assign the action setting The shapes can be copied and pasted on as many slides as may be needed The shapes can be placed ... Suppose you have a list of open invoices that contain company name and amount due You can trigger the company information form to be created when you press the update button on the list of open ... is a nice, simple way for users to navigate a database, because most users are familiar with this functionality Finally the Docmd.Maximize in the Form_Activate event makes sure that the form always...
  • 45
  • 271
  • 0
Office VBA Macros You Can Use Today phần 9 potx

Office VBA Macros You Can Use Today phần 9 potx

Ngày tải lên : 14/08/2014, 09:22
... limitations The moment the database is made replicatable for asynchronous use, the AutoNumber changes from the default +1 into a randomly created number Office VBA: Macros You Can Use Today Acs Example ... data, mistakes can occur Before storing the data, you can test to ensure that mandatory fields have been completed You can also check that related fields (like start and end dates) are logically ... charts in an Excel workbook using a PowerPoint presentation is a time consuming task when done by the traditional manual cut and paste Now, you can create that presentation easily using VBA Example...
  • 45
  • 403
  • 0
Office VBA Macros You Can Use Today phần 10 ppsx

Office VBA Macros You Can Use Today phần 10 ppsx

Ngày tải lên : 14/08/2014, 09:22
... 428 Office VBA: Macros You Can Use Today Notes Office VBA: Macros You Can Use Today page 429 Notes page 430 Office VBA: Macros You Can Use Today Notes Office VBA: Macros You Can Use Today page ... Macros You Can Use Today page 415 Appendix A – Using Visual Basic Editor Apx page 416 Office VBA: Macros You Can Use Today Appendix B –Running a Macro Appendix B Running a Macro There are many ways ... Using the Visual Basic Editor Appendix A Opening and Using the Visual Basic Editor You can open the Visual Basic Editor (VBE) from within any Microsoft application by either of two methods You can...
  • 45
  • 297
  • 0
Bài tập tiếng anh lớp 3 (mới) Unit 16: Do you have any pets?

Bài tập tiếng anh lớp 3 (mới) Unit 16: Do you have any pets?

Ngày tải lên : 09/08/2016, 13:31
... VnDoc - Tải tài liệu, văn pháp luật, biểu mẫu miễn phí VnDoc - Tải tài liệu, văn pháp luật, biểu mẫu miễn phí ...
  • 3
  • 1.7K
  • 25
Bài tập tiếng anh lớp 3 (mới) Unit 15 Do you have any toys?

Bài tập tiếng anh lớp 3 (mới) Unit 15 Do you have any toys?

Ngày tải lên : 10/08/2016, 11:31
... VnDoc - Tải tài liệu, văn pháp luật, biểu mẫu miễn phí VnDoc - Tải tài liệu, văn pháp luật, biểu mẫu miễn phí ...
  • 3
  • 1.4K
  • 18
55136 what can you do

55136 what can you do

Ngày tải lên : 28/08/2016, 11:01
... L I S F E S L N K O O I G V R Y Y R A U Y L L E P D D R E A N G C B I C W J V D R I T R I Z B W T U J A E L F Y E T L G O A N C E D A W N I N A D S A W S I U M C N U C D O L I K C R I Z...
  • 2
  • 146
  • 0