why the making of a global anti money laundering regime
underhill - global financial integration thirty years on; from reform to crisis (2010)
Ngày tải lên :
01/11/2014, 19:47
... shifts the attention to East and Southeast Asia while equally examining financial regionalism and its potential tension with global governance To say the least, the Asian financial crisis has catalysed ... CPIA DAC Asian Bond Fund Asian Bond Market Initiative Asian Monetary Fund Anti- Money Laundering Annual Report on Exchange Arrangements and Exchange Restrictions (IMF) Association of South-East Asian ... financial architecture, public policy and regulation Global financial integration and the governance of the global monetary and financial system stand at a crossroads after over thirty years of...
- 376
- 660
- 0
FROM CREATIVE ACCOUNTING PRACTICES AND ENRON PHENOMENON TO THE CURRENT FINANCIAL CRISIS pptx
Ngày tải lên :
23/03/2014, 00:20
... creative accounting, fraud comes from an illegal act; the difference between the two consists of the illegal and deliberate nature of the act that caused the damage IFAC defines fraud as a deliberate ... creative accounting with its legal and illegal sides that have appeared on the agenda of important companies and governments They examine a particular type of creative accounting practices (fraud) ... out of a steady accumulation of habits and values and actions that began years before and finally spiraled out of control” (McLean and Elkid, p 132-133) Remaining in the sphere of serious accounting...
- 8
- 696
- 1
Assessment and solutions to the current water source pollution in man xa craft village casting aluminum and lead in van mon, yen phong, bac ninh
Ngày tải lên :
28/04/2016, 13:35
... in the two Craft Villages Man Xa and Dai Bai Notes: NT1: Pond Craft Village of Dai Bai NT2: Pond Craft Village of Man Xa QCVN: Standards Vietnam Man Xa and Dai Bai are two Villages casting aluminum ... of Man Xa is relatively low because production duration to cast aluminum and lead is much shorter than that of Dai Bai; also the scale of production in Man Xa is smaller than Dai Bai Date analysis: ... the analysis of wastewater in Man Xa Village we see that the waste water has been contaminated Samples of wastewater had originated mainly from domestic wastewater therefore; their values of Coliform,...
- 58
- 525
- 0
Vietnam’s exports to the eu Situation and recommendations.doc
Ngày tải lên :
27/10/2012, 16:55
... economist Adam Smith (1776) first put the trade theory of absolute advantage as follow:” Absolute advantage is the ability of a nation to produce a good more efficiently than any other nation” In other ... proportions theory differs considerably the theory of comparative advantage Recall that the theory of comparative advantage states that countries specialize in producing the good that it can produce ... Nowadays, in the tendency of globalization and regionalization, no country can stand apart from the process of trade and investment liberalization From the facts during the past years, Vietnam-EU...
- 35
- 805
- 3
China’s banking reform: Issues and prospects for the future
Ngày tải lên :
26/10/2013, 16:15
... Restricted Roadmap to the presentation Why all care for China’s financial reform? An assessment of the banking reform so far A Restructuring of SOCBs B Financial liberalization C Regulation and supervision ... America, spreads even higher and also profitability 13 Restricted How are banks doing? (cont’) Garc a- Herrero, Gavilá and Santabarbara (2006) analyze empirically the main drivers of the improved ... Particularly for capital adequacy! – The spirit of the low probably more important than the letter of the law Better corporate governance: Strengthened functions and accountability of board of directors...
- 20
- 471
- 0
Introduction to the basic approaches and issues of Intrusion Detection
Ngày tải lên :
04/11/2013, 13:15
... to the sunrpc port On the other hand, these are not servers, so let us assign a neutral value of to criticality As for lethality of the attack, there is some data exchange, so the attack is at ... criticality of the target and lethality of the attack, and the effectiveness of system and network countermeasures • Impact is calculated by the analyst • Delays in detection and reaction can increase ... Note that data is transferred from the mail relay to the attacker, but not the other way around What kind of information did the attacker receive? Most likely, the attacker is collecting banner...
- 34
- 445
- 0
Tài liệu Capitalize this- a guide to the proper care and feeding of capital letters doc
Ngày tải lên :
20/12/2013, 18:15
... geologists call this material “garbage”) is often deposited in formations called morains Capitalize the personal pronoun I A CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize the names of ... usually not after a name Joe Chuckles, who was chairman of the board of directors in 1995, has since retired A CAPITAL IDEA! The Uses and Rules of Capital Letters You can capitalize the names ... Don’t capitalize directions They moved up north, to the southern shore of Lake Erie A CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize names of days of the week, months, and holidays...
- 13
- 658
- 1
iec 60076-4 power transformers - guide to the lightning impulse and switching impulse testing
Ngày tải lên :
25/12/2013, 10:35
... waves are the main criteria of the test result The presentation of the recordings for the acceptance test are the same as for the presentation of oscillograms in 7.5.2.2 The stored data in the ... case of transformers, in the vicinity of core saturation, sharp changes of current occurring at the same time as any distortion of the voltage wave are indicative of failure With the nature of ... parts of a winding or even between windings or to earth These types of fault cause a significant change in the voltage wave either as a complete collapse of the wave or a shortening of the tail...
- 132
- 729
- 11
Tài liệu The Culture That Gave Rise To The Current Financial Crisis pptx
Ngày tải lên :
16/01/2014, 22:20
... marketplace—came to be seen as a quaint anachronism, a relic of an era long gone The proximate causes of the current financial and economic crisis are usually laid to easy credit; the cavalier attitude ... contributions; and, in the financial arena, bestowal of wealth to traders and managers that is totally disproportionate to the value they add to investors’ wealth Indeed, the financial sector actually ... fees and structures available to other clients of the manager (6) In all, measuring up to the 1940 Act standard that funds are in fact “organized, operated, and managed in the interest of their...
- 16
- 357
- 0
Tài liệu Guide to the Successful Thesis and Dissertation doc
Ngày tải lên :
17/01/2014, 05:20
... Bologna, a candidate for the Doctor of Law degree had to take two examinations a private one and, later, a public one in the cathedal The private examination was conducted by the faculty of doctors ... courses of study leading to the Master of Arts and the Master of Science degrees As far as a master’s degree in a profession is concerned, probably the first was the Master of Pedagogy, also offered ... and state and federal publications carried the material Virtually all investigations, though, dealt with matters that could be approached by the collection of factual data, examining the data in...
- 355
- 502
- 0
Environmental barriers to trade of the united states and implications for vietnam
Ngày tải lên :
06/02/2014, 20:27
... Vietnam in ASEAN, Regional Intergration Process and Challenges, Hanoi 14 Damien J Neven (2000), Evaluating the effects of non-tariff barriers, University of Lausanne 15 The Australian APEC Study ... http:/thietbiphantichmoitruong.wordpress.com/2011/04/08/rao-can-moi-truongquan-trac-moi-truong-lien-tuc 43 http://environment-safety.com/courses/EnvManagement/envStandards.htm 44.http://vea.gov.vn/vn/khoahoccongnghe/nhanxanh/gioithieunhansinthai/Pages 45 http://www.census.gov/foreign-trade ... Centre-Monash University (2003), European Unilateralism-Environmental Trade Barriers and the Rising Threat to Prosperity through Trade Website 16 http://www.census.gov/foreign-trade/statistics/index.html...
- 25
- 593
- 0
Tài liệu REPORT TO THE PRESIDENT PREPARE AND INSPIRE: K-12 EDUCATION IN SCIENCE, TECHNOLOGY, ENGINEERING, AND MATH (STEM) FOR AMERICA’S FUTURE docx
Ngày tải lên :
12/02/2014, 19:20
... 36 states and the District of Columbia had adopted the common core standards in mathematics and English language arts There is also considerable interest in the adoption of similar standards ... 33. Although the formulation of standards for K-12 education in technology-related subject areas has not yet reached the same level of maturity, organizations such as the National Academy of Engineering, ... education PCAST also heard presentations on STEM education from representatives of the Office of Management and Budget, the Department of Defense, the National Science Foundation, the National Aeronautics...
- 142
- 634
- 1
Tài liệu THE ENCYCLOPEDIA OF HOLLYWOOD: AN A TO Z GUIDE TO THE STARS, STORIES, AND SECRETS OF HOLLYWOOD docx
Ngày tải lên :
19/02/2014, 10:20
... great films such as Amadeus (1984) Yet there are also some absolutely dreadful adaptations, such as Man of La Mancha (1972), arguably one of the worst adaptations in the history of the cinema Most ... stars For the most part, animals have traditionally played supporting roles to human actors, but a number of assorted animals have managed to ascend to a star status of their own Animals, of ... only major female star was Alice Faye, and Ameche was often teamed with her Ultimately, the pair were the leads of many of Fox’s cheery musicals of the late 1930s and early 1940s, among them:...
- 561
- 659
- 0
No Holds Barred Fighting: The Ultimate Guide to Conditioning Elite Exercises and Training for NHB Competition and Total Fitness pot
Ngày tải lên :
05/03/2014, 21:20
... without an actual partner, grab a heavy bag and lay it on the mat Lie cross-body on the bag placing your diaphragm against the bag Stay off your knees and arch your diaphragm into the bag .The only ... breath control is as vital as technique, and it is advisable to make it a regular part of your training.As a matter of fact, there should be no aspect of your training where you are not aware of ... the same exercise after a series of jump squats, as stated in the previous pattern, to learn to control the breath after a scramble.These two exercises are of significant value because they adhere...
- 257
- 634
- 1
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
Ngày tải lên :
07/03/2014, 12:20
... cellulose via a (beta-Ala)2 spacer The quality of the synthetic peptides on spots was evaluated by mass spectrometry analysis and the amount of peptides on spots was determined by HPLC analysis after ... presence of 25 lm free Ca2+, the aspartateto-alanine mutations in the N-terminal half of CaM (hCaM-EF12) increased the dissociation constant for binding of the N1-peptide by a factor of (KD ¼ ... form a very stable heteromeric association complex with the C-terminal domain of Ca2+-free CaM, i.e apoCaM The activation of these channels is mediated by conformational changes in the CaM ⁄...
- 13
- 500
- 0
Export to the world market and to North America ppt
Ngày tải lên :
09/03/2014, 02:20
... physical/technical federal agency Germany RINA Registro Italiano Navale Italian ship classification association Italy SAA Standards Association of Australia Australia SABS South African Bureau of ... to the world market and to North America Approval authorities Code Full title Country CSA Canadian Standards Association Canadian standards association, Canadian standard Canada DEMKO Danmarks ... Gesellschaft zur Prüfung und Zertifizierungvon NiederspannungsgerätenGerman test laboratories association Germany ANSI American National Standards Institute USA AS Australian Standard Australia ASA American...
- 44
- 459
- 0
www.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toDiscover how to upgrade your existing website to the latest HTML5 and CSS3 standardsDushyant KanungoBIRMINGHAM - MUMBAIwww.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toCo ppt
Ngày tải lên :
16/03/2014, 03:20
... with the ID canvas-bg can be placed in a hidden div tag and later can be used as a background for any graph or chart, or any other graphic One of the most practical applications of the text and ... denote an area that is thematically distinct from another area on a page; for example, a news area and a blog area 20 www.it-ebooks.info Instant Migration to HTML5 and CSS3 How-to Menu versus Nav ... of hCard in the web page gives the crawlers a sense of authenticity of the information and organizational behavior Similarly, Date/Time can also be implemented with the publishing date of the...
- 68
- 489
- 0
Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc
Ngày tải lên :
16/03/2014, 16:20
... tagged by amplifying the hprK alleles of pGP204 and pGP628 using the primers SH1 (5¢-AAACCGCGGCAATGAAAAAG TTATTAGTCAAGGAG) and SH3 (5¢-AAAGGATCC GGTCTGCTACTAACACTAGGATTCATC) The PCR fragments were ... transferred to a fresh reaction tube and the reaction was stopped (96 °C, min) The fractions were then separated on a native polyacrylamide gel, analyzed using the TINA quantification software ... analysis supports the idea that G154 plays a structural rather than an enzymatic role: the mutant G15 4A is still active as a kinase, suggesting that it can bind ATP Indeed, the Kd of this mutant...
- 8
- 340
- 0
Báo cáo " Thailand’s inadequate response to the 2008 Economic Crisis: Implications for Vietnam and other countries entering the East Asian economic model " pptx
Ngày tải lên :
22/03/2014, 13:20
... (on the basis that large-scale infrastructure projects are being financed at least in part by the Asian Development Bank and other international partners) The first package, known as SP1, was aimed ... It then goes on to describe and analyse the stimulus package and other measures taken by the Thai government as a means of combating the economic crisis and then provides a critique of that response ... recovery of the Thai economy, which has of course fallen most harshly on the poor and the vulnerable The Vietnamese context Thailand has reached what the World Bank has called the Middle Income Trap:...
- 10
- 449
- 1
Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc
Ngày tải lên :
23/03/2014, 00:20
... biodiversity in a number of ways It may result in the degradation or complete removal of a natural habitat through excessive water abstraction, or the splitting up of a habitat as a result of road construction ... habitat fragmentation For example, Sutherland et al (2011 PR) highlight that over 30% of the 8,900 km2 forests of the State of Pennsylvania have been made available for natural gas extraction, although ... confirmed that development of well pads in forest areas in Pennsylvania affects a wider area than the site area itself It was estimated that the area indirectly affected would be approximately an additional...
- 292
- 586
- 0