who shall survive a new approach to the problem of human interrelations
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
... give an illustration of the
behavior of the morphological and syntactic
parsers on a more complicated example:
Ngarrka-ngku.ka marlu marna-kurra luwa.rnu
ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974.
Barbara Brunson*
AT&T Bell Laboratories
and
Department of Linguistics
University of Toronto
Toronto, Ontario, Canada M5S 1A1 .
Abstract
We present a model of morphological
processing ... namely prosody and the non-
isomorphism of syntactic and phonological
structure. We maintain that these are are
central to the task of a morphological analyzer
and, hence, have incorporated...
- 8
- 522
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... GTGTGATCTGCAACTGTT
OMCA-PBAD-F CACCGAGGAATAATAAATGATG
AAACGGTTCAATTTC
OMCA-PBAD-R TTAGTTACCGTGTGCTTC
OMCB-PBAD-F CACCGAGGAATAATAAATGATG
AACGCACAAAAATCA
OMCB-PBAD-R TTACATTTTCACTTTAGT
Shewanella oneidensis ... CACACTGCAACCTCTGGT
OMCA-KO-R ACTGTCAATAGTGAAGGT
OMCB-KO-F CCCCATGTCGCCTTTAGT
OMCB-KO-R TCGCTAGAACACATTGAC
OMCA-F ATGATGAAACGGTTCAAT
OMCA-R TTAGTTACCGTGTGCTTC
OMCB-F CTGCTGCTCGCAGCAAGT
OMCB-R GTGTGATCTGCAACTGTT
OMCA-PBAD-F ... MR-1R was used as a positive control to display omcA
(lane 1) and omcB (lane 6). DNA standards are indicated at the left
and right of the agarose gels. (B) Visualization and separation of
high...
- 11
- 731
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
Ngày tải lên :
23/03/2014, 14:20
... Italian), pastarant (pasta + restaurant)
and peatza (pizza + eat). These three suggestions are
amusing and have a nice ring to them. As a matter
of fact, it turns out that the name Eatalian is actually
used ... eating), pizza and pasta
(which are found AtLocation restaurant) to generate
an appropriate name. The three “palatable” neolo-
gisms generated are eatalian (from the combination
of eat and Italian), ... Computational Linguistics
A Computational Approach to the Automation of Creative Naming
G
ă
ozde
ă
Ozbal
FBK-Irst / Trento, Italy
gozbalde@gmail.com
Carlo Strapparava
FBK-Irst / Trento, Italy
strappa@fbk.eu
Abstract
In...
- 9
- 518
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
Ngày tải lên :
10/06/2014, 21:42
... not only the Messiah and the
Son of God but also the Son of Man who will be seated at the right
hand of God and will come ‘with the clouds of heaven’ at the climax of
history to gather in the elect ... the ritual of the Day of Expiation.
1 John may also have in mind the ceremony on the Day of
Expiation, when it speaks of Christ as the hilasmos (means of expi-
6
See D. P. Wright, ‘Day of Atonement’, ... blessed and broke
it, and gave it to them, and said: “Take, this is my body.” And he took
a cup, and when he had given thanks he gave it to them, and they all
drank of it. And he said to them,...
- 322
- 436
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
Ngày tải lên :
21/06/2014, 19:20
... in the passband but also in the transition
band. The mean value of the group delay ranges below that of
linear-phase filters of the same length. The observed overall
signal delay lies within the ... group
delay was proposed that is based on the Remez exchange
algorithm. With the mentioned approaches a filter group
2 EURASIP Journal on Advances in Signal Processing
delay can always be obtained that ... shown
that his algorithms for the constrained design of digital
filters with arbitrary magnitude and phase responses have the
potential to achieve a considerable reduction of group delay
as compared to...
- 13
- 623
- 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
Ngày tải lên :
20/02/2014, 16:20
... judgment, all words in the upper
branch of the hierarchical tree are related to the
hand sense of palm, and all other words are related
to its tree sense. However, it is somewhat unsatis-
factory ... vectors. To see this, let us
bring our attention to the various species of ani-
mals that are among the top 30 associations to
poach. Some of them seem more often affected by
cooking (pheasant, ... consid-
ered as one of its senses. A problem that we see
with this approach is that it allows only as many
senses as clusters, thereby limiting the granularity
of the meaning space. This problem is avoided...
- 4
- 536
- 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
Ngày tải lên :
08/03/2014, 04:22
...
vector comparisons. Fortunately, the problem of
data sparseness can be minimized by reducing the
dimensionality of the matrix. An appropriate alge-
braic method that has the capability to reduce ... salient.
Also, widely and rural are well within the adjective
cluster. The comparison of the two dendrograms
indicates that the SVD was capable of making ap-
propriate generalizations. Also, when ... number of rows to a vocabulary appropriate for
evaluation purposes. Since we are not aware of any
standard vocabulary previously used in related
work, we manually selected an ad hoc list of 50...
- 4
- 433
- 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
Ngày tải lên :
15/02/2014, 20:20
... 135
Human Capital and Transformational Change 137
Human- Capital Management in Government 138
Challenges Facing Human Resources Managers 139
Challenges in Sustained Leadership 142
A Human- Capital ... McNabb entered a second career in academia. He
advanced to the rank of professor on the faculty at Pacific Lutheran University.
He has a BA from California State College at Fullerton, an MA from ... Only then can they integrate the new way of operating into the
organization’s culture.
External causes of an organizational crisis can spring from any of the uncontrol-
lable factors that result...
- 288
- 2.4K
- 0
A new approach to financial regulation: the blueprint for reform potx
Ngày tải lên :
29/03/2014, 18:20
... stability strategy and Financial Policy Committee
(1) After Part 1 of the Bank of England Act 1998 insert—
“P
ART 1A
F
INANCIAL STABILITY
Financial stability strategy of the Bank
9A Financial stability ... recognising that the regulators are best placed to determine the nature of
the regulatory action which should be taken. The same arrangements will also apply to the FCA.
Governance
2.68 As with the ... Further amendments of Bank of England Act 1998
P
ART 2
A
MENDMENTS OF FINANCIAL SERVICES AND MARKETS ACT 2000
Financial Conduct Authority and Prudential Regulation Authority
5 The new Regulators
Regulated...
- 413
- 413
- 0
Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt
Ngày tải lên :
20/06/2014, 21:20
... contributed equally to the content of the article
and gave their final approval. All authors read and approved the final
manuscript.
Competing interests
The authors declare that they have no competing ... processes associated with hydrological events such as floods.
Furthermore, there is a large body of literature describing the interaction of contaminants associated with
particulate matter to aquatic ... re-suspension
of sedime nts may have a major impact on aquati c biota.
Unfortunately, no research is available combining
hydraulic stresses, sedimentological response and result-
ing bioavailab ility of...
- 5
- 435
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2