when the carrying amount of assets and liabilities recognised in a business combination differs from their tax base

Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

Ngày tải lên : 25/10/2012, 10:06
... chest pain In order for chiropractors to have a role in managing chest pain from the point of entry, they must acquire and demonstrate competence in diagnosing the complaint Chest pain can have a ... interplay between 'diagnosis' and 'treatment' whether in managing a given patient in actual practice or in attempting to define an appropriate evidence-based professional 'standard of care' This ... providers, and that the nature of the referral (e.g., amount and type of information accompanying the referral) may depend on the nature of the condition, whether the referral is for reasons of diagnosis...
  • 10
  • 788
  • 0
Situational analysis of the socioeconomic conditions of orphans and vulnerable children in seven districts in Botswana pot

Situational analysis of the socioeconomic conditions of orphans and vulnerable children in seven districts in Botswana pot

Ngày tải lên : 06/03/2014, 01:22
... centre of Ngamiland It is the headquarters of numerous safari and air-charter operations It was founded in 1915 and was named the tribal capital of the Batswana people It is a place that has had a ... actions However, they are aware of the antiretroviral (ARV) treatment programme and they encourage their clients to test and enrol with the programme as and when appropriate The home-based care ... parent(s) who are terminally ill and incapable of caring for the child; and • ‘have been abandoned and [left] in need of care and are not catered for under the orphan care programme’ The • • • •...
  • 76
  • 391
  • 0
The inpatient burden of abdominal and gynecological adhesiolysis in the US docx

The inpatient burden of abdominal and gynecological adhesiolysis in the US docx

Ngày tải lên : 28/03/2014, 14:20
... adhesions of ovary and fallopian tube Laparoscopic lysis of adhesions of ovary and fallopian tube 65.89 Other lysis of adhesions of ovary and fallopian tube 70.13 Lysis of intraluminal adhesions of vagina ... results, and drafting the manuscript AJ and MW contributed clinical expertise and guidance and assisted in interpreting the analysis results and drafting the manuscript text Page of All authors ... should be of interest to providers and commercial and government payers Further research incorporating detailed clinical data and indirect costs would aid in a greater understanding of the overall...
  • 9
  • 449
  • 0
Báo cáo lâm nghiệp: "Amounts of throughfall and lysimetric water in a sub-mountain beech forest in the Kremnické vrchy Mts" ppt

Báo cáo lâm nghiệp: "Amounts of throughfall and lysimetric water in a sub-mountain beech forest in the Kremnické vrchy Mts" ppt

Ngày tải lên : 07/08/2014, 03:22
... On average, of the total amount of gravitational water from the soil surface only 65.6% reached the depth of 10 cm and only 26.2% percolated into the depth of 25 cm In the opened plot, the values ... running in interaction with plants, soil, and water balance – which was already pointed out by Papritz et al (1991) and Flückiger and Braun et al (1992) The differences in the soil water balance ... belonging to the area of the West Carpathian Mts The species composition is dominated by beech, the stand age is 80–110 years In terms of climate, the plots are situated in moderately warm, moderately...
  • 5
  • 400
  • 0
Báo cáo khoa học: "Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations" pps

Báo cáo khoa học: "Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations" pps

Ngày tải lên : 09/08/2014, 03:22
... because of anatomical variation or difficult veins (small veins; no palpable landmarkers) Anatomical variations of the internal jugular vein were found in 8% of patients studied with ultrasound-guided ... Piacenza e Parma, Pro Loco Gazzola, I Fantastici Author details Oncology-Hematology Department, Hospital of Piacenza, Piacenza, Italy Department of Medicine, AUSL Piacenza, Italy 3Teaching and ... was registered when presented Statistical analysis Demographic data and clinical features were analyzed using descriptive methods Quantitative variables were summarized using mean and standard...
  • 7
  • 422
  • 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Ngày tải lên : 11/08/2014, 15:22
... Ministry of Education authorized and facilitated the study The following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education ... boards of the Kuwait Ministry of Education and the Kuwait Society for the Advancement of Arab Children (KSAAC) Thereafter, the Principal of each selected school was approached for approval and ... model of Jirojanakul et al [13], the results of the regression analyses showed that variables from the personal factors (age and sex), parental factors (parental marital status and father’s occupation),...
  • 12
  • 500
  • 0
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

Ngày tải lên : 12/08/2014, 03:21
... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT ... ACTGAAAAAAAATGAAGACTA 32 90 - 100 ED019743 BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA ... DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAA FokI-satellite 130 60 81 - 100 DX979624 GGGACTTAGGAGAGTGACCCAACCAAGGAGGGAGACCTCCTTGGGCTGAGT GGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTG...
  • 14
  • 270
  • 0
Báo cáo khoa học: "Effects of dopexamine on the intestinal microvascular blood flow and leucocyte activation in a sepsis model in rats" pptx

Báo cáo khoa học: "Effects of dopexamine on the intestinal microvascular blood flow and leucocyte activation in a sepsis model in rats" pptx

Ngày tải lên : 13/08/2014, 02:24
... the aim being to maintain adequate oxygen delivery to all organs and to the gut in particular In addition to noradrenaline (norepinephrine), adrenaline (epinephrine), dopamine and dobutamine, ... was performed to maintain airway patency, and the animals breathed room air spontaneously The left jugular vein and carotid artery were cannulated with polyethylene catheters (PE50; inner diameter ... began after completion of the endotoxin infusion Animals in CON group and in LPS group were given an equivalent amount of normal saline To test the hypothesis that administration of dopexamine...
  • 8
  • 380
  • 0
Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

Ngày tải lên : 13/08/2014, 09:21
... the intensities of the bands in the lanes with recombinant PFV proteins shown in Fig and amounts of protein Relation of the intensities of the bands in the lanes with recombinant PFV proteins ... pETpol3 was made alike with #1219 (5'gttatgtgcatatgtgtaataccaaaaaacc) and #1413(5'tgcgctctcgagatttttttccaaatg) All plasmids were sequenced in their FV parts to verify correct insertions and to exclude ... relative amounts of Gag and Pol proteins in purified PFV Representative example of the determination of the relative amounts of Gag and Pol proteins in purified PFV (A) Extracellular virus was centrifuged...
  • 7
  • 318
  • 0
The Position and role of small and medium enterprises in a national economy – the case of Japan

The Position and role of small and medium enterprises in a national economy – the case of Japan

Ngày tải lên : 01/11/2014, 22:05
... Shizuoka and the lower rank three: Okinawa, Miyazaki and Nagasaki Japan consists of 47 prefectures) by using statistical data on the size of the enterprise and prefectural income (typical index that ... reached a peak of 319,716 companies but the numbers have been declining since then In the latter half of the 1960’s, a comparatively remarkable increase in the number of SMEs with a capital scale of ... phase is from actual growth of SMEs and from the change in the process of the selection (can be guessed here) The factor analysis on the business environment, the market situation, and the management...
  • 31
  • 743
  • 0
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY

THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY

Ngày tải lên : 01/06/2015, 20:09
... demographics of the participants and the statistical analyzes are also presented to interpret and understand the results 4.1 DEMOGRAPHIC CHARACTERISTICS OF THE PARTICIPANTS There was a total sample ... of analysis, the population, the sample, the sampling technique, the measurement, the collection and administration of data, the technique of analyzing data The study was intended to be carried ... organizational change and establish its strategic direction In reality, the relationship between the leaders and employees is 15 a causal link and has a mutual link on each other The leader behaviors...
  • 84
  • 510
  • 1
The relative importance of earnings and other information in the valuation of rd intensive firms

The relative importance of earnings and other information in the valuation of rd intensive firms

Ngày tải lên : 30/09/2015, 16:44
... persistence in abnormal operating earnings, growth in operating earnings, conservatism in the accounting for operating assets, and other information Abnormal earnings, operating assets and other information ... show that there is a small increase in the ability of earnings and book values to explain share prices when the capitalization policy is followed In addition, when the components of eamings and ... forecasts are used is that analysts incorporate information other than the past history of earnings into their forecasts of future earnings If there were an increase in the importance o f other information...
  • 79
  • 273
  • 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Ngày tải lên : 25/10/2012, 10:39
... study and manuscript revision JK was involved in the design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript ... were involved in drafting the manuscript MG participated in analysis and interpretation of the data and in drafting the manuscript PS, JS and MV contributed to the conception and design of the ... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Ngày tải lên : 19/02/2014, 05:20
... densitometric tracing of the autoradiograms; for each target site, the intensity of the R53 band resulting from p53 binding to unmodified DNA was taken as 1.0, and the intensities of bands corresponding to ... and the ability of the particular p53 target site to accommodate the cisplatin IACs The higher the probability of formation of the cisplatin IACs within the p53DBSs due to the occurrence of the ... respectively) At rb ¼ 0.06, the p2 1a target retained 45% of the p53 binding, thus exhibiting at least four times higher binding capacity than the natural p21 p53DBS treated in the same way Binding of p53...
  • 14
  • 597
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Ngày tải lên : 23/03/2014, 03:20
... [8] indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the ... identification of the corresponding proteins in the database (Table 2) Database search and functional exploration of these proteins revealed that they were associated with gluconeogenesis and glycolysis In ... Hernandez-Fernaud and E Salido Proteome changes in primary hyperoxaluria and males develop calcium oxalate crystalluria and calculi in the urine bladder, although no deposits in the renal parenchyma...
  • 9
  • 481
  • 0
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Ngày tải lên : 23/03/2014, 20:20
... Metonymic interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the people Language and Artificial Intelligence, Makoto ... Shin-ichiro and Wakao, Takahiro (1992) Metonymy: reassessment, survey of acceptability, and its treatment in a machine translation system Locating 1.1 Container for Content Dave drank the glasses ... in acceptability (for the details, Kamei and Wakao 1992) Based on both intuitive analyses and the result of the survey, we have esta, blished four major patterns, and several sub-groups for the...
  • 3
  • 453
  • 0
Báo cáo lâm nghiệp: "development of winter hardiness of pine and spruce seedlings in a simulated acid rain experimen" potx

Báo cáo lâm nghiệp: "development of winter hardiness of pine and spruce seedlings in a simulated acid rain experimen" potx

Ngày tải lên : 09/08/2014, 04:20
... to the unhardened state in March-April, when the starch grains again appeared (Fig 4) The exposure to acid rain did not were seen to accumulate in chloroplasts The develfreezing injury in the acid ... results clarify the development of cold hardiness at the ultrastructural level The hardening began in mid August and the maximum earlier than the southernmost seedlings, whereas in pine seedlings ... containing granular material developed in the cytoplasm Myelin-like membranous formations in the cytoplasm became abundant during the winter period (Fig 3) As of September, small, single-membrane...
  • 3
  • 214
  • 0
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx

Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx

Ngày tải lên : 13/08/2014, 20:21
... that died of ARDS had evidence of pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack ... the primary cause of death was an anoxic brain injury On the otherhand, patients may have confirmation of anoxic brain injury at autopsy, but the primary cause of death was overwhelming sepsis ... manuscript, and performed the statistical analysis MGJ participated in the design of the study, drafting the manuscript, and was clinically responsible for the patients All authors read and approved the...
  • 7
  • 265
  • 0
Báo cáo sinh học: "Detecting parent of origin and dominant QTL in a two-generation commercial poultry pedigree using variance component methodology" docx

Báo cáo sinh học: "Detecting parent of origin and dominant QTL in a two-generation commercial poultry pedigree using variance component methodology" docx

Ngày tải lên : 14/08/2014, 13:21
... For example, if the test of patvfull is significant the model incorporating paternal and maternal QTL is explaining more variation than the paternal QTL indicating some level of maternal expression ... containing the probability of identity of descent between any of the two gametes of an individual with the gametes of the remaining individuals in the pedigree [25] Where P1 is the paternally ... parents [41] Because heritability estimates are based on the contrast of between and within family variance and QTL variance is based mainly on within family variance low trait heritability is not...
  • 11
  • 628
  • 0

Xem thêm