waiver of in vivo bioavailability and bioequivalence studies for immediate release solid oral dosage forms based on a biopharmaceutics classification system guidance 2000

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20

... various forms has become a great national institution, and annual displays of activity and strength are now celebrated in every village in the country Prizes and medals are eagerly competed for; ... science, learning, and discovery, its contributions to national and global politics and culture, and its inevitable controversies and scandals University Oars University Oars is a compilation of letters ... weak for several years afterwards, but I have had no return of the complaint, and am now in U o 18 UNIVERSITY OARS a pretty fair state of health, being able to stand a considerable amount of...

419
541
0

Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot

Ngày tải lên : 16/03/2014, 01:20

... et al (2005) A microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi ... this minireview was to provide, in overview, a summary of the potential application of miRNAs as diagnostic and therapeutic targets in cancer TranslaƟonal repression Fig miRNA generation and gene ... serve as unique targets for diagnostic imaging in vivo for taxonomic classiﬁcation of tumors [24] The emerging role of miRNAs in neoplasia highlights their potential value as mechanism -based therapeutic...

8
432
0

Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc

Ngày tải lên : 17/03/2014, 10:20

... 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), ... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... This already demonstrates the importance of the N-terminal domain for dimer-formation Under nonreducing conditions all of the cysteine mutant proteins display only a small amount of monomeric form...

8
405
0

Báo cáo khoa học: "In vivo morphological and antigenic characteristics of Photobacterium damselae subsp. piscicida" doc

Ngày tải lên : 07/08/2014, 20:23

... identified bands at 52, 44, and 21.3 kDa using sea bass sera raised against live bacteria, and bands at 52, 44, 39.5, 34.7, and 21.3 kDa with sea bass sera raised against formalin inactivated cells ... 68, and 79 kDa, while bacteria cultured in the HMW bag in vivo had bands at 27, 34, 39, and 79 kDa Staining of the 27 and 79 kDa bands of bacteria cultured in HMW bag in vivo was particularly intense, ... shown in Lane 4, Lane 4: bacteria maintained in vivo in 25 kDa dialysis tubing (LMW bag), Lane 5: concentrated ECP of bacteria shown in Lane 6, Lane 6: bacteria maintained in vitro in 300 kDa dialysis...

7
270
0

báo cáo khoa học: "C-band variants of telocentric chromosomes in swine : evidence and inheritance studies" ppt

Ngày tải lên : 09/08/2014, 22:23

... used, for example, in gene mapping studies in swine using family investigations (FRIES et al., 1982 and FRIES, 1982), as it was applied in human genetics, and for laboratory animals In pairs 13 and ... by applying sequential staining with DA-DAPI and C-banding it can be shown that the C-band variants correspond exactly to the DA-DAPI (FRIES, 1982) Inheritance studies of C-band variants were already ... Acknowledgements EEMAN AUBER We like to thank Miss lr6ne K and Mr M L for technical assistance, and the Swiss Association for Artificial Insemination and the farmers who provided information and blood samples...

9
211
0

Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa

Ngày tải lên : 13/08/2014, 09:21

... upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' ... 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' The 141 bp U3 region was removed from the plasmid by BglII digestion and the plasmid religated BamHI and XbaI ... cotranslational packaging and competition for limiting Gag polyprotein [13] These differences in the location of the major packaging determinants may contribute to the ability of viral mRNA to...

14
437
0

Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx

Ngày tải lên : 13/08/2014, 11:22

... removed ADDRESS, ADministration of DRotrecogin alfa (activated) in Early Stage Severe Sepsis; APACHE, Acute Physiology and Chronic Health Evaluation; DrotAA, drotrecogin alfa (activated); PBO, placebo; ... clinical trials and data collection WLM, JJ, and DRN participated in the conception and design of the study, in the development and conduct of analyses, and in drafting the manuscript MDW participated ... participated in drafting the manuscript JFD participated in the clinical trials and data collection All authors contributed to the analysis and interpretation of the data and to critical review, revisions,...

13
341
0

evidence of biodegradation of atmospheric carbon tetrachloride in soils field and microcosm studies

Ngày tải lên : 13/11/2014, 16:00

150
140
0

sex determination in drosophila biochemical and functional studies of transcription factor doublesex

Ngày tải lên : 14/11/2014, 08:21

228
241
0

IN VIVO MECHANICAL AND PHYSIOLOGICAL CHARACTERISATION OF LOWER LIMB SOFT TISSUE BY a LOCAL INDENTATION TECHNIQUE

Ngày tải lên : 09/10/2015, 11:24

... repeatability in the positioning and alignment of the probe Maintaining a constant indentation rate by hand is almost impossible 15 ii Indentation Rate The effect of indentation rate on the extraction ... generation can be referred to as nonlinear analysis as they involve of consideration nonlinear material properties, nonlinear geometry and nonlinear 10 boundary conditions including friction/slip ... of experimental and FE-predicted indentation reaction force against indentation depth for location 1,1 (patellar tendon) 66 Graph of experimental and FE-predicted indentation reaction force against...

143
593
0

Tài liệu Báo cáo khoa học: "The Eﬀect of Corpus Size in Combining Supervised and Unsupervised Training for Disambiguation" pdf

Ngày tải lên : 20/02/2014, 12:20

... Sarkar, and Mark Steedman 2003 Corrected co-training for statistical parsers In Workshop on the Continuum from Labeled to Unlabeled Data in Machine Learning and Data Mining, ICML Mark Johnson and ... text categorization research J Mach Learn Res., Dekang Lin 1998 Dependency -based evaluation of MINIPAR In Workshop on the Evaluation of Parsing Systems, Granada, Spain LingPipe 2006 i.com/lingpipe/ ... generative, lexicalised models for statistical parsing In ACL Alexander S Yeh and Marc B Vilain 1998 Some properties of preposition and subordinate conjunction attachments In Coling Donald Hindle...

8
515
0

Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

Ngày tải lên : 21/02/2014, 15:20

... structures and lie close to each other, and a substantial conformational change in the C-terminal domain is induced The key heparin-binding site of basic amino acids in both peptides is located at a site ... critical sites for heparin binding, and the orientation of dimerization Investigation into the structure–function relationships of LPL continues to provide important information for understanding ... chimeras of hepatic lipase and lipoprotein lipase Localization of heparin and cofactor binding J Biol Chem 273, 30979–30984 22 Sendak, R .A & Bensadoun, A (1998) Identiﬁcation of a heparinbinding...

10
679
0

PULMONARY TUBERCULOSIS IN HIV INFECTION IN TANZANIA clinical and immunological studies pdf

Ngày tải lên : 22/03/2014, 18:20

... health care facility in northern Tanzania Also, the prevalence of HIV infection in in-patients and the proportion of patients unaware of HIV infection as the cause of their ailing health are examined ... France system) Demographic information and the status of the patient at discharge were extracted from discharge and HIV testing logs An additional set of data, based on a chart review, was generated ... Kublin JG, Borgstein E, Zijlstra EE Prevalence and indicators of HIV and AIDS among adults admitted to medical and surgical wards in Blantyre, Malawi Transactions of the Royal Society of Tropical...

234
436
0

Báo cáo khoa học: LRRK2 in Parkinson’s disease: in vivo models and approaches for understanding pathogenic roles pdf

Ngày tải lên : 23/03/2014, 04:20

... understanding of the disease mechanisms in vivo The application of BAC transgenics is especially advantageous over conventional transgenics for studying LRRK2 The main reasons are: (1) generation of ... mutants, indicating that dLRRK is dispensable for the survival of dopaminergic neurons [30,31] In addition, Wang et al [30] showed that mutant ﬂies containing C-terminal kinase domain truncated ... phosphorylate eukaryotic initiation factor 4E-binding protein, a negative regulator of eukaryotic initiation factor 4E-mediated protein translation and a key mediator of various stress responses...

10
527
0

Báo cáo hóa học: " Research Article Audio Key Finding: Considerations in System Design and Case Studies on Chopin’s 24 Preludes" pdf

Ngày tải lên : 22/06/2014, 23:20

... papers at national and international conferences such as the International Conference on Music Information Retrieval (ISMIR), International Conference on Multimedia and Expo (ICME), and the INFORMS ... proposed, in assembling a key-finding system The in- depth evaluation and qualitative analysis of all approaches are given in Section BASIC SYSTEM We first construct our basic audio key-finding system as ... modified spiral array (mSA) approach, fundamental frequency identification (F0), and post-weight balancing (PWB) Qualitative and quantitative analyses and evaluations of the three extensions are presented...

15
426
0

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identiﬁcation in a Wireless Software-Deﬁned Radio Approach" pptx

Ngày tải lên : 23/06/2014, 01:20

... simulation modeling and performance evaluation,” in Proc 4th International ACM Workshop on Modeling, Analysis and Simulation of Wireless and Mobile Systems, Rome, Italy, July 2001 Matteo Gandetto ... transmit a large number of modes in different bands The SDR approach is a great evolution based on the programmable digital radio (PDR) paradigm, which consists in a radio fully programmable in baseband ... radio -based terminal His research interests are in mode identification algorithms for software-defined radio platform in a single and multiuser scenario 1790 Carlo S Regazzoni is Associate Professor...

13
455
0

current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010

Ngày tải lên : 25/07/2014, 13:57

... officials and staff of outpatient clinic Completely supplement devices, apparatus and suitable wage and welfare system to maintain and promote activities of collaborator and peer in taking – care and ... working rooms, waiting area and consulting area for the patients, area for storing and delivering medicines for the patients, area for keeping and storing records, medical records In this research, ... clinic for audults in studying location 3.1.1 Actual situation of supplying of caring, supporting and treating services to AIDS patients in in outpatient clinic for audults in studying location Outpatient...

27
364
0

Báo cáo khoa học: "Comparative efficacy of standard AGID, CCIE and competitive ELISA for detecting bluetongue virus antibodies in indigenous breeds of sheep and goats in Rajasthan, India" potx

Ngày tải lên : 07/08/2014, 18:21

... breeds of small ruminants encompassing a large area of Rajasthan state in India These animals can serve as a potential source of infection to other domestic animals in the region The c-ELISA was ... sero-positivity among the indigenous sheep above years of age indicates that BTV infection was common among adult animals These adult animals may be a potential source for spread of BTV in this region Although, ... Rajasthan State alone accounts to 25% and 13% of the total Indian population of sheep and goats, respectively Most of the sheep are of indigenous types and there is a general understanding that...

3
298
0

Báo cáo khoa học: " Evaluation of serum chondroitin sulfate and hyaluronan: biomarkers for osteoarthritis in canine hip dysplasia" pps

Ngày tải lên : 07/08/2014, 20:24

... chemicals, including aspartate aminotransferase, alanine aminotranferase, blood urea nitrogen and creatinine Biomarker assay The biomarker assay that uses ELISA follows a previous study that was done ... hyaluronan assay in serum, and this was based on previous work with HA binding proteins [32] Human serum samples or standard HA (Healon; Pharmacia Pharmaceutical AB, Sweden) at various concentrations ... topographical areas of normal articular cartilage from dogs Coll Relat Res 1988, 8, 39-47 40 Masuhara K, Nakai T, Yamaguchi K, Yamasaki S, Sasaguri Y Significant increases in serum and plasma concentrations...

9
522
0