volatile commodity prices and the development challenge in low income countries

TOWARDS BETTER LEADERSHIP AND MANAGEMENT IN HEALTH: REPORT ON AN INTERNATIONAL CONSULTATION ON STRENGTHENING LEADERSHIP AND MANAGEMENT IN LOW-INCOME COUNTRIES potx

Ngày tải lên : 08/03/2014, 14:20

... further strengthen health leadership and management in low- income countries Although the specific focus was on low- income countries, the consultation concluded that the framework and many of the ... as recurring themes critical to leadership and management development in low- income countries These are grouped below according to the four dimensions of the framework In general: • There are ... vital for raising the profile of leadership and management strengthening, and for making the case for investing in such activities The diagram below illustrates how the inputs, processes and outputs...

35
470
0

báo cáo sinh học:" Public-private partnerships to build human capacity in low income countries: findings from the Pfizer program" docx

Ngày tải lên : 18/06/2014, 17:20

... selection, training, and matching of Fellows to Organizations Other problems generally contributing to the lack of success in achieving Fellowship goals included: ▪ The Fellow did not have the skill ... about reasons for approving the Fellowship, preparation, how work was covered in the Fellow's absence, and the impact of the program on the Fellow, the Pfizer workgroup, and the company Partner Organization ... philanthropy", with the dual goal of addressing social problems while also furthering the company's strategic interests and expanding core business [13] Strengthening health services in poor countries...

11
560
0

báo cáo sinh học:" Health workforce skill mix and task shifting in low income countries: a review of recent evidence" pptx

Ngày tải lên : 18/06/2014, 17:20

... cadres, has been occurring for decades in both high -income countries (e.g in the USA, see Hooker) and low- income countries, but is seen by some as becoming more urgent in low- income countries because ... literature, focusing on task shifting in lowincome countries Task shifting is defined as delegating tasks to existing or new cadres with either less training or narrowly tailored training Dovlo describes ... important intellectual content SS participated in the acquisition and interpretation of the studies and drafting the manuscript EA, AS, and MV participated in the study concept and design, and drafting...

11
600
0

báo cáo khoa học: " The growing caseload of chronic life-long conditions calls for a move towards full selfmanagement in low-income countries" ppsx

Ngày tải lên : 11/08/2014, 14:21

... in living with the disease, in how the disease changes their lives and in gaining some control over the course of their illness They know how to interpret physical signs and the reaction of their ... around 50% of the total disease burden in 23 selected low and middle income countries and showed that the age-standardised death rates for chronic diseases were higher than in high income countries ... empowering approach are the involvement of people with CLLC and their carers in the design of the systems, for instance by patient advisory bodies, changes in staff training, recruitment and valorisation,...

10
419
0

Báo cáo y học: "Further benefits by early start of HIV treatment in low income countries: Survival estimates of early versus deferred antiretroviral therapy" potx

Ngày tải lên : 10/08/2014, 05:21

... potential benefit The objective of this study is therefore to estimate the life years gained with early and late treatment strategies in low income countries In the absence of randomized clinical trials, ... [39] and Malawi [14] and one multicentre study from several low income countries (ART LINC) [9] The number of patients included in our pooled-analysis is 35 047 The principal outcome measure in the ... applying low and high mortality rates and ages in the Markov model High and low mortality rates in the sensitivity analyses are based on upper and lower values of the 95% weighted confidence intervals...

9
276
0

the relationship between corporate social responsibility implementation and the development of five selected companies in hanoi

Ngày tải lên : 13/03/2014, 14:20

... Vai river); food poisoning (case of Melamine infected in infant milk); and other cheating in selling products to customers (the fraud in selling fuel) After suffering these cases, society requires ... company in food and beverage industry From establishing in 1976, Vinamilk has successful in operating business, since 2008 to now, Vinamilk has started aligning CSR into company’s strategy The table ... balance these three dimensions, and adapt this concept into business strategy Then the company can satisfy higher and higher demands of customers, and be able to sustainability development in business...

67
845
0

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Ngày tải lên : 12/08/2014, 04:21

... designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... primers PVM3 and PVM4, a NcoI site was revealed in PVM isolates detected in Germany, Italy, Russia, Poland and China, but not found in the isolates detected in the US (Idaho strain) and Canada ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the...

7
452
0

Báo cáo y học: "The specificity and the development of social-emotional competence in a multi-ethnic-classroom" pptx

Ngày tải lên : 13/08/2014, 18:21

... parents return from their trip The Lost Key: The child enters the room and hears mother and father arguing over a lost key The Exclusion: Mother and father want to be alone and send the child to its ... at the end of the kindergarten year than at the beginning (see Table 5) The first consideration concerned the ethnic and gender differences in social-emotional competence at the beginning and the ... differ in moral reasoning at the end of the kindergarten year At the beginning of the kindergarten year the gender groups differed in moral themes as well as in dysregulated aggression and dissociation...

10
283
0

FU LEI AND THE DEVELOPMENT OF CULTURE IN MODERN CHINA

Ngày tải lên : 06/10/2015, 21:23

... later meet with the Sun brothers in France and holiday together Jin Mei, p 72 56 ‘Faxing tongxin shiwu pian’ in Fu Lei wenji: wenyijuan, pp 23-77 The series was later collated in Cao Juren’s anthology ... Illustrious Men’ series in French Romain Rolland, ‘Letter from Romain Rolland to the translator: on non-resistance’, 30 June 1934, reproduced in Mingren zhuan (Nanjing: Yilin chubanshe, 2008), pp ... Belknap Press of Harvard University Press, 1964) 17 Theodore Huters, Bringing the world home: appropriating the West in late Qing and early Republican China (Honolulu: University of Hawaii Press, 2005),...

112
730
0

Cambridge.University.Press.Press.Politics.and.the.Public.Sphere.in.Europe.and.North.America.1760-1820.Jul.2002.pdf

Ngày tải lên : 21/09/2012, 10:58

... question When combined with the propaganda potential of the printing press to disseminate such ﬁndings, printing became a major force behind the success of the Reformation and the secularisation ... extinguished the public sphere in the Netherlands in both  and , in Italy, in revolutionary France and, to a slightly lesser extent, in Napoleonic Germany In the Napoleonic period, the ... Despite lingering worries about the effects of the press and other forms of print on the lower orders, governments were beginning to encourage increased educational provision, and literacy was rising...

275
861
2

A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese

Ngày tải lên : 06/04/2013, 08:43

... ‘lean’,’ incline’, ‘be’ - The same corrupt dispositions which incline men to sinful ways of getting, will incline them to the like sinful ways of spending." (Henry, M.) (10) In order to show the act ... their idioms, their synonyms and other microlinguistic factors that effect the uses of the two verbs The findings of the study on the ground of general meanings may help the translators to find ... discussed Then the findings are reached with the statements on the similarities and differences between the objects of the study This chapter is followed up with the analysis and contrast the “run” and...

52
1.9K
25

Mythological creatures and the chinese zodiac in origami

Ngày tải lên : 15/08/2013, 15:57

119
895
2

THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY

Ngày tải lên : 07/09/2013, 13:48

... allows to determine the Theme/ Rheme boundary The Interpersonal Theme includes all elements coming before the topical Theme that express interpersonal meaning The interpersonal part of the Theme ... dictionary!; Close the window !) The two variables of speech role (giving and demanding), and the variables of commodity (information and goods and services), when taken together, define the four basic ... participant saying, telling, stating, informing, asking, demanding, offering, threatening, suggesting and so on, The Sayer can be a human or human-like speaker, and also any other symbolic source Other...

59
1.1K
13

A study on the aspects of syntax and semantics of negation in english and the contrastive analysis in vietnamese

Ngày tải lên : 11/12/2013, 23:53

... designed in parts: Part A is the Introduction giving the reasons for choosing the topic, the aims of the study, the scope of the study, the methods and the design of the study 13 Part B is the Development ... connective according to the internal role they have inside logic, regardless of meaning they are intended to have (if any) The semantic point of view, in contrast, is based on the intuitive meaning of ... pronoun The negative form above includes indefinite pronoun as the subject of sentence But in this kind, the indefinite pronoun is placed after the main verb as the object of sentence For instance:...

51
1.1K
8

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

Ngày tải lên : 29/01/2014, 00:23

... would be interesting to investigate their uses in them all However, in order to make our tasks manageable in keeping the aims of the study, within the time allowance, it is intended that the most ... improving reading skill and in doing some English-Vietnamese translation I found that students still have many problems in understanding the texts, and especially in interpreting the writers opinion ... and by other linguistic and paralinguistic devices Also, in this chapter, basic knowledge about modal verbs in English and in Vietnamese is provided And finally, to consolidate the analysis and...

56
2.6K
19

Tài liệu Default and the Maturity Structure in Sovereign Bonds∗ docx

Ngày tải lên : 16/02/2014, 02:20

... time-varying differences in the prices, and in the liquidity and insurance benefits of these two assets, which rationalize the movements in spread curves and maturity composition observed in the data ... their median relative to when spreads are below their median in the model and in the Brazilian data Debt duration in the model mirrors the dynamics of duration in the bond data of Brazil In the ... concave and β = We also now consider a different income process Income in period is equal to 0, income in period is equal to y, and income in period can take two values: y H or y L with y H > y L The...

42
425
0

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20

... position in the field of development finance and this increases their potential to innovate in development approaches and financial instruments Not only MDBs in the region operate within the international ... system in the LAC region We have gathered several indicators about their interactions with other MDBs and other financial and development institutions, their relative position in the development financing ... Multisector and Other; banking and financial services, and business and other services are Financing and Business; and government and civil society - general and conflict, peace, and security...

35
481
0

Real Return Bonds, Inﬂation Expectations, and the Break-Even Inﬂation Rate ppt

Ngày tải lên : 06/03/2014, 08:20

... calculated from these two yields Table shows the sample means and measures of the variability of the nominal and real yields and the BEIR The drop in the mean and variability of the BEIR in the latter ... explain the declining differential between the BEIR and survey measures of inflation expectations over the mid-1990s In fact, there has been an improvement in liquidity since the beginning of the ... between the interest rate measure and realized inflation Kandel, Ofer, and Sarig justify this proxy with the following example: in a given month, investors not transact in all goods included in the...

47
457
0

Human Capital and the Development of Financial Institutions: Evidence from Thailand docx

Ngày tải lên : 06/03/2014, 10:20

... savings and lending services In the Northeast, only 17% of the banks offer savings and lending In the Central region, 40% of the banks offer both savings and lending services In the Northeast, the ... same as the minimum loan size decreases by 5% The training of the money manager is also important in determining whether the maximum loan is equal to the minimum loan Having accounting training reduces ... Median Annual Income includes income from wages and salaries and net income from farming, livestock and business activities Income is measured in current (1997) baht At the time of the survey,...

38
515
0

Báo cáo " Long-term sediment distribution calculation taking into account sea level rise and the development of Day estuary " potx

Ngày tải lên : 10/03/2014, 18:20

... filled in near future To avoid bad consequences caused by the filling Day river mouth, dredging and widening of the river are of great importance Ninh Binh province implements the project "Dredging ... 19050’N) Figure shows the increasing trend of water level (red line) Magnitude of the increase is consistent with the increase projected in the sea level rise scenarios in section 5.4 Calculation ... estuaries such as Day, Ninh Co and BaLat, the largest area is 25km2 in offshore region The domain includes 2879 nodes with the coarse resolution of 5000m for offshore and the fine resolution of 50m...

6
463
0