use of xylanase as a pulp brightener domtar canada
Animal waste utilization effective use of manure as a soil resource
Ngày tải lên :
16/03/2014, 11:44
... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... capacity as a standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders ... neither waste nor asset (Dittrich, 1993) Manure was largely viewed as a farm asset up until the early 1960s At that time the theme of manure as a waste, as something to be disposed of, began to...
- 319
- 5.6K
- 0
Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot
Ngày tải lên :
11/08/2014, 21:22
... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy ... ketamine is being used increasingly as a recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware of the problem and ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table...
- 3
- 391
- 0
A contrastive analysis of moderating criticism The use of disjuncts as mitigating hedges in verbal communication
Ngày tải lên :
10/08/2015, 19:46
... languages and in interlanguage of English learners of different language backgrounds such as House and Kasper (1981), Tracy, Van Dusen, and Robison (1987), Tracy and Eisenberg (1990), Wajnryb ... contrastive analysis (CA), and survey questionnaires It also deals with informants and procedures of the data collection Chapter 4: Data analysis and findings: This chapter analyses collected data to ... Research Articles Amsterdam/ Philadelphia: John Benjamins Publishing Company 22 James, C (1983) Contrastive Analysis Essex: Longman Group Ltd 23 Kasper, G (1992) Pragmatic transfer Second Language...
- 6
- 555
- 1
Use of alkalifeldspar as bed material for upgrading a biomassderived producer gas from a gasifier
Ngày tải lên :
29/07/2016, 14:02
... °C Fluidization of the catalyst batch is achieved using either a mixture Gas analyzer Micro-GC Gas condiƟoning SPA He Gasifier Raw gas Reactor (4) (5) Mixing chamber Oven SPA Raw gas Gas condiƟoning ... comparable catalytic activity, the alkali-feldspar would outperform most of the other materials The goal of the present study is to validate the use of this alkalifeldspar as a catalyst for upgrading ... technique can be deployed as a secondary gas cleaning measure or can be introduced as a primary measure in existing processes, whereby the catalyst will undergo cyclical exposure to raw gas and to a regenerating...
- 12
- 284
- 0
A contrastive analysis of encouraging as a speech act in english and vietnamese
Ngày tải lên :
26/11/2013, 13:31
... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, ... describes and analyzes the syntactic and pragmatic features of 2.2.2.2 Classifications of speech acts directives in English and Vietnamese Searle (1975) has set up the following classification of Trương...
- 13
- 1.6K
- 8
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
Ngày tải lên :
13/02/2014, 06:20
... through a part of a disease trajectory Within nursing, Case Management has been developed and can be divided into three generations [27] As a third generation Case Manager, the NN’s approach to patients ... phase of the disease and while waiting for primary cancer treatment Methods A qualitative study was found appropriate as experiences and meanings were desired, and limited knowledge of this area ... 21 participants with a range of characteristics including age (median age 63 (range 36–79)), marital status, place of residence and gynecological diagnosis (Table 1) All characteristics in Table...
- 11
- 695
- 0
Tài liệu The Man of Letters as a Man of Business docx
Ngày tải lên :
17/02/2014, 19:20
... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...
- 21
- 544
- 0
Tài liệu Test of English as a Foreign Language doc
Ngày tải lên :
20/02/2014, 11:21
... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...
- 36
- 869
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
Ngày tải lên :
07/03/2014, 02:20
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...
- 10
- 483
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
Ngày tải lên :
07/03/2014, 15:20
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... )346/)214 Total chromatin (lanes and 10), and no DNA (lanes and 6) were used as positive and negative PCR controls As a marker (lane M), the 100-bp gene ruler (Fermentas) was used isoforms Furthermore,...
- 8
- 426
- 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
Ngày tải lên :
16/03/2014, 05:20
... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt, ... 10)4 s)1 Rmax values decreased, as expected, with increasing baseline A dissociation constant of 64 nm for the GABARAP–CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology...
- 13
- 560
- 0
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/medium_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
Ngày tải lên :
23/03/2014, 15:20
... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... protein was precipitated and washed carefully with methanol–chloroform [31] The protein concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation...
- 10
- 477
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
Ngày tải lên :
25/03/2014, 10:41
... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...
- 28
- 764
- 2
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
Ngày tải lên :
30/03/2014, 15:20
... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identification of the reaction ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...
- 17
- 440
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
Ngày tải lên :
18/06/2014, 19:20
... the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital status, educational level ... activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities ... sex, martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher...
- 9
- 844
- 0
Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf
Ngày tải lên :
21/06/2014, 17:20
... elemental analysis of samples Sample EF FW Table Elemental analysis of graphite and graphite-g-TMPBA Sample Elemental analysis Elemental analysis C (%) H (%) C (%) O (%) As- received graphite Pyrene ... 700 amu The covalent attachment of TMPBA onto pyrene could be confirmed by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) analysis (Fig 2) A series of peak groups appeared, ... the purpose of having a basic understanding of the starting material, pristine graphite was characterized by elemental analysis (Table 2) When theoretical C H N O contents were calculated, the...
- 6
- 392
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
Ngày tải lên :
23/06/2014, 00:20
... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s ... Polish Acad Sci Math 51 (2003), no 2, 147–156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (1993), no 3, 819–821 S Prieß-Crampe, Der Banachsche...
- 6
- 268
- 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx
Ngày tải lên :
28/06/2014, 17:21
... that in writing of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft! Perhaps not; and yet I would rather...
- 126
- 362
- 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx
Ngày tải lên :
28/06/2014, 17:21
... that in writing of the Man of Letters as a Man of Business I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; ... Scribner's Magazine; "Confessions of a Summer Colonist" was done at York Harbor in the fall of 1898 for the Atlantic Monthly, and was a study of life at that pleasant resort as it was lived-in ... as the first form, is so often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will often have wider acceptance as a book from having...
- 130
- 318
- 0