use of simulated body fluid for predicting the in vivo bone bioactivity of a material

Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

Ngày tải lên : 12/08/2014, 18:21

... preoperative therapy, or basal haemodynamic and respiratory data (time point 1, Table 1) Table lists the mean amounts of fluids infused during the study Table Mean amounts of fluids infused during the ... collection of haemodynamic data, at each time point two blood samples were drawn (one from the radial artery cannula and another from the distal port of the pulmonary artery catheter) in order to measure ... radial artery cannula and pulmonary artery catheter [Arrow AH 050050-H, 7.5 F; Arrow International, Inc., Reading, PA, USA] transcutaneous oxygen saturation probe), vancomycin (15 mg/kg) was administered...

6
260
0

Báo cáo y học: " Evaluation of SOFA-based models for predicting mortality in the ICU: A systematic review" docx

Ngày tải lên : 13/08/2014, 11:23

... Hospital Total Max SOFA Kajdacsy-Balla Amaral et al (2005) [7] 0.841 ICU Total Max SOFA + Infection Kajdacsy-Balla Amaral et al (2005) [7] 0.845 ICU Total Max SOFA + Infection + Age Kajdacsy-Balla ... score measured in a prespecified time interval, and mean SOFA was always calculated by taking the average of all total SOFA scores in the prespecified time interval These intervals varied in length, ... compared a model based on max SOFA alone with a model including max SOFA and infection, and a model including max SOFA, infection and age [7] The last model had very good calibration and discrimination,...

13
381
0

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Ngày tải lên : 13/08/2014, 13:20

... array, the geometric mean of the measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the values of ... on the average of the intensity across the array set was then obtained A ratio greater than indicates that there was hybridization to a specific gene 2-fold above the background intensity across ... aminosaline-coated microscope slides Following printing and cross-linking, slide quality was assayed by staining a representative slide for each printing with Syto-61 and scanning at 635 nm and...

15
376
0

Báo cáo y học: "A new parameter using serum lactate dehydrogenase and alanine aminotransferase level is useful for predicting the prognosis of patients at an early stage of acute liver injury: A retrospective study" potx

Ngày tải lên : 13/08/2014, 13:20

... recognized as an enzyme released in liver injury, as are aspartate aminotransferase and alanine aminotransferase (ALT) It is common to regard monitoring serum LDH as of little value because it is ... over-activation of macrophages plays a key role in the progression of ALF [9-12] The activated and proliferating macrophages in the liver could injure endothelial cells and cause a disturbance in ... drugs other than acetaminophen, Wilson's disease and indeterminate Laboratory data were checked daily in the morning Plasma exchange was performed in the afternoon when hepatic encephalopathy was...

8
282
0

Báo cáo y học: "Diffusion-weighted magnetic resonance imaging for predicting the clinical outcome of comatose survivors after cardiac arrest: a cohort study" pptx

Ngày tải lên : 13/08/2014, 20:21

... in discriminating an unfavourable from a favourable outcome Therefore, the pattern of brain injury and quantitative measurement of regional ADC may predict the clinical outcome of comatose patients ... abnormalities in the cortex and basal ganglia, had a good neurological recovery in this study On the other hand, a normal finding of DWI indicated a high probability of a favourable outcome Among ... included cardiac arrest resulting from intracranial haemorrhage, drug intoxication, trauma or a terminal illness, a previous history of neurological disease or brain trauma, a lack of informed consent,...

11
267
0

standard specification for producing a skid-resistant surface on concrete by the use of a multi-component epoxy s

Ngày tải lên : 24/10/2014, 22:12

... suitable for the aggregate gradation specified in Article 2.2.2.1 and aggregate rate of application specified in Article 2.3.4.2 If either of these is changed the coating application rate may have ... and coating rate of application specified in Article 2.3.4.1 If either of these is changed the aggregate application rate may have to be adjusted and a sample should be prepared to evaluate the ... control -The inspector shall determine that coating and skid-resistant aggregate are applied at a rate at least equal to that specified and that aggregate and coating are securely bonded The pullout...

6
242
0

(SPE 156394) A Numerical Model for Predicting the Rate of Sand Production in Injector Wells

Ngày tải lên : 26/09/2016, 11:03

... confining stresses ( and ) Additional deformation after the peak results in the softening of the material and shrinkage of the yield surface This is demonstrated in Fig 2-b by the downward arrows ... dilation angle The last three parameters are expressed as a function of the hardening parameter that is itself a function of principal plastic strains For the sake of brevity, the details of the constitutive ... laboratory experiments indicate that granular materials usually demonstrate strain softening at Low Effective Confining Stress (LECS) and strain hardening at the state of High Effective Confining...

8
368
0

(SPE78168MS) New Model for Predicting the Rate of Sand Production

Ngày tải lên : 26/09/2016, 11:43

... with the measured data The over-prediction of the continuous sanding rate, by a factor of typically two to four, is seen as acceptable when using these data for sizing facilities sand handling capabilities ... testing of the model Table provides a summary of formation properties over the perforated intervals analyzed However, as the model takes into account the half-foot-byhalf-foot variability of in- situ ... and 3.8, depending upon the amount of post-failure softening Comparable internal research by BP investigated the TWC collapse resistance of a number of sandstones having a variety of OD/ID ratios,...

9
583
1

Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

Ngày tải lên : 23/03/2014, 19:20

... fold A binary feature is included for each of the following: the presence in the sentence of a pronoun, an adjective, a cardinal number, a modal other than will, and an adverb other than not We also ... develop an automatic classifier The revision of the coding manual results in as much as a 16 point improvement in pairwise Kappa values, and raises the average agreement among the judges to a Kappa ... m a t e s of these parameters are obtained, each clause can be assigned the most probable latent category given the tags assigned by the judges The EM algorithm takes as input the number of latent...

8
354
0

báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx

Ngày tải lên : 19/06/2014, 08:20

... and Dr Mei Wang for giving their comments on the initial draft of the manuscript The financial support from The Ralph and Marian Falk Medical Trust Foundation and the Rehabilitation Engineering ... be used to assess the user's initial and final capability ROM when using an input device and optionally used to map between the input device workspace range and the user's capability range by a ... reaching, tracking, and coping with instability) that may relate to ADLs A suite of kinematic measures were developed to examine various movement features in each type of goal-directed tasks The...

15
361
0

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Ngày tải lên : 20/06/2014, 01:20

... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...

11
854
0

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

Ngày tải lên : 20/06/2014, 04:20

... protein and a transcriptional transactivator fusion protein consisting of the GAL4 DNA-binding domain fused to the activation domain of NFκB These effector cells were mixed with a separate set of ... interpretation The assay described herein is a means of quantifying the fusion activity of the HRSV F protein This assay has multiple applications For example, this assay can be used as a means of studying ... (Stratagene®, La Jolla, CA) was used to change leucine 138 in the fusion peptide region of the F protein to an arginine (pL138R) in pHRSVFOptA2 Plasmids pBD-NFκB encoding the activation domain of...

12
541
0

Cutting Tool Materials What is the use of a book docx

Ngày tải lên : 27/06/2014, 23:20

... plotted against hardness to indicate the range of influence of each tool material and the comparative relative merits of one material against another, with some of their physical and mechanical properties ... uncomplicated tooling database for later interrogation Having established the current status of the tooling within the manufacturing facility, this allows for a tooling rationalisation campaign to ... doubling the depth of cut this can, in the main, allow for a larger nose radius – assuming that the component feature allows access If an increase in nose radius cannot be utilised, then increasing...

31
455
0

Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps

Ngày tải lên : 09/08/2014, 01:21

... Information on where to access further parenting courses in managing the child’s behaviour and psychoeducational materials are made available When pharmacological therapy is recommended, the various ... 30:70 in a UK paediatric ADHD clinic Practical considerations for initiating MPH treatment At the start of treatment with any MPH formulation, careful dose titration is necessary IR and long-acting ... with the family is maintained, including an action plan and plan for reviews Children started on medication are usually seen in the clinic after month, and the optimal dose is determined They are...

24
597
0

Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

Ngày tải lên : 10/08/2014, 05:20

... well as facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of ... participating states had laboratory reporting of at least some CD4 counts and viral loads at the time of the study and the third had an established, clinically-based HIV reporting system that ... based on race and sex, and sampled within each provider using systematic sampling within race/sex strata from an ordered list The sampling interval was varied in the different race/sex strata...

7
337
0

báo cáo khoa học: "The importance of organizational characteristics for improving outcomes in patients with chronic disease: a systematic review of congestive heart failure" pdf

Ngày tải lên : 10/08/2014, 10:23

... events by the addition of a clinical pharmacist to the heart failure management team: results of the Pharmacist in Heart Failure Assessment Recommendation and Monitoring (PHARM) Study Arch Intern ... being cared for Diseases may mediate the way that interventions influence a patient’s care The level of complexity of different diseases, and the ways that chronic diseases Page of 10 impact patients’ ... and the strength of outcomes reported, as well as between each individual characteristic and the strength of outcomes Because a mismatch between the unit of allocation and analysis may bias a...

10
502
0

Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

Ngày tải lên : 11/08/2014, 11:20

... was a temporal relation between the onset of clinical deterioration of our patient and the use of a known offending agent, skin manifestations of palpable purpura, rash, biopsy of leukocytoclasis ... progressively advancing borders and muscular involvement, subcutaneous air, and undermining of the epidermis [14] Also, surgery and pathology indicated intact fascial plains with edema, and the absence of ... complaining of a chest pain that began suddenly that morning while she was resting in bed She described the chest pain as sharp and non-radiating in the peristernal area Deep breaths and movement exacerbated...

7
468
0

Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

Ngày tải lên : 11/08/2014, 14:20

... twodimensional transvaginal sonogram revealed a sac situated external to the endometrial cavity in the right cornua of the uterus (>1 cm from the most lateral edge of the uterine cavity) containing an embryo ... pregnancy, are used in the medical literature interchangeably By definition, a cornual pregnancy refers to the implantation and development of a pregnancy in the lateral upper portion of the uterus, ... Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of...

4
341
0

báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps

Ngày tải lên : 11/08/2014, 20:21

... manufacturer’s software, Galaxis To increase the accuracy of the assessment, all three planes (sagittal, axial, and coronal) were utilized CBCT images were taken at two time frames; once at the ... program calculated the entire image volume from the data of 200 individual exposures generated from a pulsed scan and required for image generation Image manipulation was carried out using the manufacturer’s ... resorption of permanent teeth is an inflammation caused by varying factors, including injury to the root surface followed by dental trauma, surgical procedures, non-vital teeth bleaching, and mechanical...

5
352
0

$Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx$

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Ngày tải lên : 11/08/2014, 21:22

... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal...

4
342
0