use of multiple values for dx and dy in a text span

Báo cáo hóa học: " Use of Genetic Algorithms for Contrast and Entropy Optimization in ISAR Autofocusing" doc

Báo cáo hóa học: " Use of Genetic Algorithms for Contrast and Entropy Optimization in ISAR Autofocusing" doc

Ngày tải lên : 22/06/2014, 23:20
... consists of a comparison of ISAR images obtained from the same data by means of the deterministic and genetic algorithms The ISAR images relative to the Boeing 737 data, obtained by means of the GA and ... The GA replaces both the estimation of the initial guess and the final focusing parameters In fact, GAs not need an initial guess This may represent an additional advantage because the performance ... 1185–1191, 1996 [6] M Martorella, B Haywood, F Berizzi, and E Dalle Mese, “Performance analysis of an ISAR contrast based autofocusing algorithm using real data,” in Proceedings of IEE Radar Conference,...
  • 11
  • 407
  • 0
Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Ngày tải lên : 10/08/2014, 21:23
... part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting the manuscript OS and HL took part in revising the manuscript critically for important intellectual ... room and can be performed within a few minutes Therefore the VSA is highly suitable for routine clinical examination and for studies requiring a large number of participants We found that age and ... navicular tuberosity and the line between the markers on calcaneus and first metatarsal head The distance between the floor and the line in standing position between the markers on calcaneus and...
  • 7
  • 461
  • 0
Báo cáo khoa học: Selectivity of pyruvate kinase for Na+ and K+ in water/dimethylsulfoxide mixtures docx

Báo cáo khoa học: Selectivity of pyruvate kinase for Na+ and K+ in water/dimethylsulfoxide mixtures docx

Ngày tải lên : 08/03/2014, 02:20
... lactate dehydrogenase The concentrations of Na+ and K+ were varied as indicated and (CH3)4NCl was added in each case to give a final salt concentration of 100 mM in order to maintain constant ... detection (10 lM) Assay of pyruvate kinase activity The formation of pyruvate was measured at 25 °C in a coupled system with lactate dehydrogenase and NADH [30] In water or in the binary water/dimethylsulfoxide ... Swann, A. C & Albers, R.W (1975) Sodium-potassium-activated ATPase of mammalian brain regulation of phosphatase activity Biochim Biophys Acta 382, 437–456 Swann, A. C (1983) Brain (Na+, K+)-ATPase...
  • 9
  • 460
  • 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Ngày tải lên : 16/03/2014, 14:20
... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and characterization of a serine ⁄ threonine protein kinase pknI from Mycobacterium tuberculosis H37Rv Protein Expr ... release of Pi was measured, using the malachite green method, at various time points The Pi release was assayed when ATP or GTP was used as a substrate of EmbR Each time point is the average of...
  • 11
  • 402
  • 0
Báo cáo lâm nghiệp: " The use of ultrasonic detectors for water stress determination in fruit trees" docx

Báo cáo lâm nghiệp: " The use of ultrasonic detectors for water stress determination in fruit trees" docx

Ngày tải lên : 09/08/2014, 04:20
... continuing in order to evaluate the technique for assessing plant responses to drought in the field and as a means of measuring physiological water stress References apple (Malus x domestica Borkh.) ... that a marked diurnal pattern existed where ,AE followed radiation (PAR) levels approximately, except in some instances when !4E increased, or continued, during the night (Fig 2) using which AEs ... 43-52 Sandford A. P & Grace J (1985) The measurement and interpretation of ultrasound from woody stems J Exp Bot 36, 298-311 Dixon M .A (1983) Cavitation Thuja occidentalis L.? Ultrasonic acoustic...
  • 4
  • 187
  • 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot

Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot

Ngày tải lên : 11/08/2014, 12:20
... hospital’s Pediatric Intermediate Care Unit Pain was managed using Paracetamol and Piritramid intravenously as needed After the surgery, the boy complained of a relapsing upper abdominal pain Laboratory ... (warm touch) General anaesthesia with endotracheal intubation was performed as total intravenous anaesthesia using Propofol and Fentanyl Cisatracurium was used as a muscle relaxant Surgery was ... is a consensus that imbalances in homoeostasis can cause critical exacerbation of SCD For that reason, it is essential to maintain normovolemia, normothermia and normoxemia during anaesthesia and...
  • 6
  • 438
  • 0
báo cáo khoa học: " Complete chloroplast genome of Oncidium Gower Ramsey and evaluation of molecular markers for identification and breeding in Oncidiinae" pot

báo cáo khoa học: " Complete chloroplast genome of Oncidium Gower Ramsey and evaluation of molecular markers for identification and breeding in Oncidiinae" pot

Ngày tải lên : 12/08/2014, 03:21
... TCAAGTATTCCATTTCACCA 113319 1828 ndhB 437 TGATCTGGCATGTACAGAATG 438 AAAGAGGGTATCCTGAGCAA 133250 2221 trnHGUG-psbA 460 AAGCGTCCTGTAGTAAGAGGA 476 GGGAAACCACTGAAAATGAG 145562 1426 accD 423 TGGTTCAATTCAATGTTGTCT ... 424 ATTCAAGGGAAGGAAACCGT 55778 1430 matK 1785 TCTAGCACACGAAAGTCGAAGT 1784 CGATCTATTCATTCAATATTTC 1931 936 trnFGAA-ndhJ 529 TCGGGATAGCTCAGTTGGTA 107 GTTTCTGCTTCACGAATATG 47650 1379 rbcL 505 AGGGAGGGACTTATGTCACCA ... TGAAATTGGTAGACACGCTGC 1059 ACCGAAGATTGTGTAGGTTG 109333 2728 psaC-ndhE-ndhG 1058 TGCTCGGGAGAAGAATAATA 1061 TTTGTGGGAACCATAAATGT 111849 1697 ndhG-ndhI-ndhA-ndhH 1095 TGAATACCAATTTGTTGAACG 1917 TCAAGTATTCCATTTCACCA...
  • 12
  • 340
  • 0
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

Ngày tải lên : 08/03/2014, 02:21
... objective of automating the generation of annotation and metadata databases to enhance search and browsing of meeting recordings This goal can be achieved by providing plugand-play databases, which are ... generates the global tab-separated files for each annotation The script also generates an SQL script that creates a relational annotation database and populates it with data from the tab-separated ... for various annotations and/ or table formats 4 Metadata: Generation of Explicit Files and Conversion to Tabular Format As mentioned in Section 2, metadata denotes here any static information about...
  • 4
  • 373
  • 0
Báo cáo khoa học: "A Gartner duct cyst of the vagina causing dysuria and dyschezia in a Yorkshire Terrier" pps

Báo cáo khoa học: "A Gartner duct cyst of the vagina causing dysuria and dyschezia in a Yorkshire Terrier" pps

Ngày tải lên : 07/08/2014, 20:23
... muscle in the lamina propria H&E stain, ×100 (B) High magnification H&E stain, ×1,000 cause dysuria, dyschezia, tenesmus, pain, and dyspareunia can occur with an increase in the size of the cyst ... because of the anatomical location adjacent to the uterus and bladder An accurate diagnosis can be obtained by radiography and ultrasonography in order to provide proper treatment In asymptomatic ... Hye-Jin Kim et al A Fig Caudal obdominal ultrasonography There was a cyst (long arrows) different form urinary bladder (UB) and uterus (short arrows) A B Fig (A) Cyst was located caudal to urinary...
  • 3
  • 286
  • 0
Báo cáo y học: "Frequency, stability and differentiation of self-reported school fear and truancy in a community sample" doc

Báo cáo y học: "Frequency, stability and differentiation of self-reported school fear and truancy in a community sample" doc

Ngày tải lên : 13/08/2014, 18:21
... of mental problems and disorders A broadband questionnaire was chosen in order to obtain information on relevant behavioural and emotional problems of adolescents In order to analyze potential ... because of not affecting any group differences age was not considered anymore in the final analyses Gender was considered as another covariate but resulted only in rather few and marginal interaction ... showed also an association with aggressive behaviour that was different from controls and later at a mean age of sixteen years truancy was amalgamated with some features of internalizing problems...
  • 11
  • 301
  • 0
Use of human altered habitats by bull sharks in a florida nursery area

Use of human altered habitats by bull sharks in a florida nursery area

Ngày tải lên : 04/09/2015, 17:13
... predominant habitat, is relatively pristine; this shark mainly swam back and forth along a transition zone between seagrass and sand bottom During tracking, FIGURE Use and selection of altered habitats ... sand substrates, where Hardhead Catfish, Gafftopsail Catfish, Bluntnose Stingrays Dasyatis say, and Atlantic Stingrays D sabina are abundant (Snelson and Williams 1981; T Curtis, unpublished data) ... D., and C E Franklin 2004 Plasma osmolyte concentrations and rectal gland mass of Bull Sharks Carcharhinus leucas, captured along a salinity gradient Comparative Biochemistry and Physiology 13 8A: 363–371...
  • 12
  • 547
  • 0
Vertical distribution of traffic generated PM2 5 and NO2 in a tropical urban environment

Vertical distribution of traffic generated PM2 5 and NO2 in a tropical urban environment

Ngày tải lên : 11/09/2015, 09:59
... The various case studies, established health risk assessment models for inhalation of particulate PAHs and PM2.5 and computation and meshing parameters of a point and slab block configuration for ... David, Associate Professor Tham Kwok Wai from the Department of Building and Associate Professor Rajasekhar Balasubramanian from the Department of Environmental Science and Engineering for their invaluable ... lungs appeared to be ultrafine and that 96% was smaller than 2.5µm (Churg and Brauer, 1997) 2.1.1 Physical Characterization 2.1.1.1 Gravimetric Mass In ambient air quality standards and characterization...
  • 272
  • 269
  • 0
Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 1

Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 1

Ngày tải lên : 11/09/2015, 10:14
... pro-caspases contain a prodomain of varying length in their N-terminal part [30, 31] Caspases with a long pro-domain, called upstream or initiator caspases, contain other domains such as Death ... 38] Caspases also mediate nuclear shrinkage by cleaving lamins [39] and membrane blebbing by targeting proteins such as Rho-associated kinase (ROCK1), p-21 activated kinase (PAK) and gelsolin [40-42] ... earliest proteins cleaved by caspases Cleavage of ICAD allows the release and translocation of CAD into the nucleus, which results in the internucleosomal fragmentation of DNA, a hallmark of apoptosis...
  • 104
  • 323
  • 0
Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 2

Role of the survival proteins hsp27 and survivin in a small molecule sensitization to TRAIL mediated apoptosis 2

Ngày tải lên : 11/09/2015, 10:15
... treatment alone was unable to induce the activation of any of the caspases investigated and exposure of HeLa cells to LY30 resulted in minimal caspase activation (less than fold increase) after 6h and ... 15B) In addition, an alternate analysis of the data for the 4h time point indicated that LY30+TRAIL treatment, and to a lesser extent LY30 alone, was inducing an early mitochondrial aggregation ... 12h of treatment However, LY30 treatment resulted in an increased caspase-8 and -9 activity at 18h In addition, we observed the appearance of a 17 kDa cleaved fragment of caspase-3 at 8h following...
  • 125
  • 234
  • 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 1 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 1 pptx

Ngày tải lên : 15/12/2013, 00:15
... Temperature 2.3.1.6 Salinity 2.3.2 Growth dynamics 2.3.3 Isolating/obtaining and maintaining of cultures 2.3.4 Sources of contamination and water treatment 2.3.5 Algal culture techniques 2.3.5.1 Batch ... production of natural plankton for feeding in commercial hatcheries may therefore appear evident, in practice the use of natural plankton often entails many constraints which will be explained in detail ... (diatoms, flagellates, etc.) and zooplankton organisms (copepods, cladocerans, decapod larvae, rotifers, ciliates, etc.), found in great abundance in the natural plankton This abundance and maximal...
  • 15
  • 789
  • 2
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 2 doc

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 2 doc

Ngày tải lên : 15/12/2013, 00:15
... raw seawater and for the maintenance of existing algal strains · prepare a 0.9% agar medium by weighing out g of agar powder and placing it into a l conical flask to which l of sea water is added ... on a large scale has lead to the bulk availability of a limited number of “algal meals”, such as spray-dried Spirulina and a spray-dried extract of Dunaliella salina The latter may be used as a ... level of algae is maintained as this may stabilize water quality The “same-tank method”, in which the algae are cultured in the same water as that of the larvae using sunlight and fertilizers, was...
  • 45
  • 654
  • 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 3 ppt

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 3 ppt

Ngày tải lên : 15/12/2013, 00:15
... microparticulate and emulsified formulations (Watanabe et al., 1983; Lộger et al., 1989) Apart from fresh bakers yeast, instant bakers yeast, marine yeast (Candida) or caked yeast (Rhodotorula) may also ... Watanabe, T., Ohta, M., Kitajima, C and Fujita, S 1982 Improvement of dietary value of brine shrimp Artemia salina for fish larvae by feeding them w3 highly unsaturated fatty acids Bulletin of ... 60% of that of a normal adult female, Fig 3.17.), are ideal for storage and transport and can be used as inocula for mass cultures Mass production of rotifers for cyst production is performed in...
  • 30
  • 553
  • 1
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 4 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 4 pptx

Ngày tải lên : 15/12/2013, 00:15
... Piedra Spain Mallorca Campos del Puerto Spain Murcia San Pedro del Pinatar B A sal Jumilla B A sal sal Punta Galera B A sal sal Catalana B A sal Spain Soria Medinaceli P(4n) A par Spain Tarragona ... par San Juan del Puerto B A sal Rolda P A par Peralta de la Sal P A par B A sal Spain Huelva Spain Huesca Spain Ibiza island Salinera Espanola Spain Jaen San Carlos Don Benito Spain Malaga Fuente ... Gulf of Kutch P A par Balamba salterns P A par Mithapur P A par Jamnagar - - India Gujarat India Bombay Vadala - - Bhayander P A par Bahinder - - Kelambakkam - - Vedaranyam - - Veppalodai - - Pattanamaruthur...
  • 29
  • 731
  • 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 5 docx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 5 docx

Ngày tải lên : 15/12/2013, 00:15
... hatching tubes for another 24 h, take subsamples again and calculate H% and HE for 48 h incubation · Hatching rate (HR): start taking subsamples and calculating HE from 12 h incubation in seawater ... factor to calculate for number of nauplii per gram of incubated cysts) calculate HE value per cone and calculate mean value and standard deviation of cones = final value · Eventually leave hatching ... (ei) and calculate mean value (E) · Hatching percentage H% = (N × 100).(N + U + E)-1 calculate H% value per cone and calculate mean value and standard deviation of cones = final value · Hatching...
  • 29
  • 791
  • 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 6 docx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 6 docx

Ngày tải lên : 15/12/2013, 00:15
... Ascorbic acid enrichment in Artemia nauplii Table 4.3.4 Variability in DHA, EPA and total (n-3) HUFA levels in enriched Artemia nauplii sampled in the laboratory (A) using a standard procedure and in ... be used to incorporate and transfer vaccines to fish larvae, and by so doing facilitating oral vaccination Table 4.3.5 Accumulation of trimetoprim (TMP) and sulfamethoxazole (SMX) in Artemia nauplii ... traditional products, a maximum DHA/EPA ratio of instead of 0.75 can be reached using standard enrichment practices The reason for not attaining the same ratio is the inherent catabolism of DHA...
  • 26
  • 567
  • 0

Xem thêm