tools for a larger set

Hướng dẫn Chụp ảnh thức ăn ...

Hướng dẫn Chụp ảnh thức ăn ...

Ngày tải lên : 14/06/2015, 10:28
... pair with the camera’s daylight white balance or gray balance setting as well as daylight-balanced film There are a variety of light modifiers available for use with these New camera models are ... Ensure that all the cables are taped down and all booms and stands are secured with counterbalancing weights Also make sure that any artificial walls are clamped and will not fall I cannot emphasize ... Editor/Production Manager: Michelle Perkins Assistant Editor: Barbara A Lynch-Johnt Editorial assistance from: Carey A Miller, Sally Jarzab, John S Loder Business Manager: Adam Richards Marketing, Sales, and...
  • 129
  • 376
  • 0
Inside words - Tools for teaching academic vocabulary grade 4-12

Inside words - Tools for teaching academic vocabulary grade 4-12

Ngày tải lên : 04/09/2013, 16:38
... for adaptations and creative applications always make my ideas more relevant for a wider range of classrooms As always, I am also grateful to have found a home in the Stenhouse family Philippa ... International Reading Association Nagy, W 1988 Teaching Vocabulary to Improve Reading Comprehension Newark, DE: International Reading Association Nagy, W E., and P A Herman 1987 “Breadth and Depth ... CONCEPTS AND VOCABULARY: CATEGORIES AND LABELS What Is Concepts and Vocabulary: Categories and Labels? C oncepts and Vocabulary: Categories and Labels is based on findings showing that the most researched...
  • 176
  • 625
  • 9
Tools for management, workshop and consulting

Tools for management, workshop and consulting

Ngày tải lên : 08/10/2013, 18:11
... Gareth Morgan (1986) Organizational Metaphors In: Cameron/ Green Morgan defined a total of metaphors for an organisation.) Normally, an individual will choose an approach and a set of tools based on ... been edited, tools have been upgraded and expanded, and many good tools have been added Collaboration with other consultants made it clear that there was a lack of tools for the accurate definition ... Note that the focus is on qualitative information and that this category does not contain many tools for working with quantitative information, which are of a statistic nature Goal setting (chapter...
  • 383
  • 487
  • 0
Free Software tools for embedded systems

Free Software tools for embedded systems

Ngày tải lên : 20/10/2013, 00:15
... microkernel (PikeOS), an approach similar to RTAI Makers of KaeilOS (http://koansoftware.com/kaeilos/), a GPL  embedded Linux distribution for industrial  applications KaeilOS supports i386 and popular arm  platforms. Other platforms supported upon  ... platforms. Other platforms supported upon  request Includes several graphical toolkits and  supports hard real­time (RTAI, Xenomai,  preemption patches) Unfortunately, KaeilOS is GPL but not  available for public download ... Ready­to­use toolchains Available from several locations for most platforms Tools to build toolchains: Buildroot and Crosstool Make it easy to create a toolchain for your exact needs Build systems: Scratchbox, OpenEmbedded (see annex section)...
  • 132
  • 425
  • 0
Tài liệu Tools for Security Testing ppt

Tài liệu Tools for Security Testing ppt

Ngày tải lên : 11/12/2013, 15:15
... This chart is located at http://www.bastille-linux.org/perl-rpm-chart.html There are also packages available for Debian here at http://packages.debian.org/cgibin/search_packages.pl?searchon=names&version=all&exact=1&keywords=b ... supports a variety of platforms including several Linux flavours: Red Hat, Mandrake, SuSe, Debian and TurboLinux Bastille is primarily developed by Jon Lasser and Jay Beale and is available at http://www.bastille-linux.org/ ... does not make it any harder for attackers to penetrate their passwords Attackers also have access to foreign language dictionaries and wordlists You can find dictionary files in a few places Try...
  • 33
  • 602
  • 0
05  interval tools for ODEs and DAEs swim08 nedialkov

05 interval tools for ODEs and DAEs swim08 nedialkov

Ngày tải lên : 12/01/2014, 21:46
... The automatic differentiation (AD) packages TADIFF and FADBAD, and now FADBAD++ (O Stauning, C Bendtsen), are instrumental in VNODE, VSPODE, ValEncIA-IVP, and VNODE-LP Applications Long-term stability ... simulations (2004) E Auer, A Kecskem´thy, M T¨ndl, H e a Traczinski Reliable surface intersection (2004) H Mukundan, K H Ko, T Maekawa, T Sakkalis, N M Patrikalakis Parameter and state estimation (2004) ... of a similar implementation, but using the ADOL-C package R Barrio uses Mathematica to compute Σ, set up a generalized ODE system, and then generate FORTRAN 77 code for evaluating TCs for the ODE...
  • 39
  • 297
  • 0
Tài liệu Professional VSTO 2005 Visual Studio 2005 Tools for Office docx

Tài liệu Professional VSTO 2005 Visual Studio 2005 Tools for Office docx

Ngày tải lên : 17/01/2014, 06:20
... private System.Data.DataSet GetDataSet() { DataSet ds = new DataSet(“MyDataSet”); DataTable myDataTable = new DataTable(“My DataTable”); ds.Tables.Add(myDataTable); DataColumn myDataColumn; DataRow ... Excel Automation Visual Basic Private Function GetDataSet() As System.Data.DataSet Dim ds As DataSet = New DataSet(“MyDataSet”) Dim myDataTable As DataTable = New DataTable(“My DataTable”) ds.Tables.Add(myDataTable) ... controls can easily consume data from a dataset or the controls can bypass the dataset and bind directly to a database Listing 2-7 provides some bare-bones code to load data from a dataset Visual Basic...
  • 339
  • 1.1K
  • 24
Tài liệu Blanking tools for the automotive industry pdf

Tài liệu Blanking tools for the automotive industry pdf

Ngày tải lên : 22/01/2014, 02:20
... the Standard Parts division operates from the Hassmersheim works which manufactures a comprehensive range of standard parts and maintains stocks ready for immediate despatch world-wide The machine ... Parallel dowel pin The pilot unit 10 can be used for a hole diameter of ~ 10 mm and is available as a finished item, 9.8 mm diameter Smaller diameters have to be ground by the Tool Making department ... Progress was rapid and soon FIBRO needed new production facilities A new factory was built at Hassmersheim on the River Neckar Once again it was a historic location, this time opposite Hornberg Castle...
  • 79
  • 936
  • 0
Tài liệu Practical mod_perl-CHAPTER 9:Essential Tools for Performance Tuning pptx

Tài liệu Practical mod_perl-CHAPTER 9:Essential Tools for Performance Tuning pptx

Ngày tải lên : 26/01/2014, 07:20
... relevant arguments ApacheBench ApacheBench (ab) is a tool for benchmarking your Apache HTTP server It is designed to give you an idea of the performance that your current Apache installation can ... PerlSetVar PerlSetVar PerlSetVar PerlSetVar PerlSetVar StatusOptionsAll On StatusDumper On StatusPeek On StatusLexInfo On StatusDeparse On StatusDeparseOptions "-p -sC" StatusTerse On StatusTerseSize ... in an array before generating the output The easiest way to get an answer is to try each approach, so we wrote the benchmark shown in Example 9-3 328 | Chapter 9: Essential Tools for Performance...
  • 26
  • 372
  • 0
Tài liệu 50 Software Tools for Speech Research and Development doc

Tài liệu 50 Software Tools for Speech Research and Development doc

Ngày tải lên : 27/01/2014, 03:20
... file formats will dominate proprietary formats Networked computers will be used for parallel computation if available Tcl/Tk and Java will grow in popularity as a base for graphical data displays ... formats that include information about the names, data types, and layout of all data in the file (For example, this permits programs to retrieve data by name.) There are many popular file formats, ... high-quality audio I/O are important CSL is a good example of an integrated hardware/software approach 50.9.7 Cross-Platform Compatibility If your hardware platform may change or your site has a variety...
  • 13
  • 412
  • 0
Content Brainstorming Tools for 2013

Content Brainstorming Tools for 2013

Ngày tải lên : 09/02/2014, 20:33
... exercise for an an oth er ute In some cases, tradition al brain stormin g meth ods may best suit your team en viron men t an d g oals For th ose wh o prefer virtual collaboration , th ere are a variety ... ical way an d lead your imag in ation in n ew direction s You can down load th e software for free with a 30-day trial offer Th e application will walk you th roug h th e process of creatin g a ... provide areas of focus for your cepts Brain Writing An altern ative meth od to brain stormin g th at tries to en courag e un iform participation with in a g roup is brain writin g Like brain stormin...
  • 4
  • 347
  • 0
Tài liệu Mathematical Tools for Physics doc

Tài liệu Mathematical Tools for Physics doc

Ngày tải lên : 12/02/2014, 16:20
... integration I’ll illustrate with an example of this in rectangular coordinates: the area of a triangle Take the triangle to have vertices (0, 0), (a, 0), and (0, b) The area is a b dA = a b (a x) /a ... constant a2 a2 ) That means that near this point, the function f behaves like x /a2 a a a a Go back to the places that it blows up, and ask what happens near there If x is a little greater than a, the ... Operators Applications to Gravity Gravitational Potential Index Notation More Complicated Potentials 212 10 Partial Differential Equations The Heat Equation Separation of Variables Oscillating...
  • 456
  • 1.1K
  • 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Ngày tải lên : 19/02/2014, 12:20
... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) ... neurons, the A1 0L rons from rat intracardiac ganglia, which are believed to mutation in PnIA again caused an increase in potency as arise primarily from a3 b2 and a3 b4 nAChRs Activity on well as a shift ... These comparatively high values indicate that a3 b2 and a3 b4 nAChR subunit interfaces Both toxins were nAChRs other than a7 * and a3 b2*, most probably an isolated by assay-directed fractionation of...
  • 15
  • 757
  • 0
Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Ngày tải lên : 20/02/2014, 03:20
... CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG CGGTCCTAGTACTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGTACTAGG CGGTCCTAGTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTACTAGG CGGTCCTAGCTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTAGCTAGG ... CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG ... U for DraIII, 2.5 U for XbaI) and incubating for h at 37 °C Phosphatase was inactivated for 20 at 65 °C DNA was then ethanol precipitated and resuspended in Tris 10 mm pH 8.0 Preparation of radiolabelled...
  • 10
  • 371
  • 0
Tài liệu Báo cáo khoa học: "Re-Usable Tools for Precision Machine Translation∗" pdf

Tài liệu Báo cáo khoa học: "Re-Usable Tools for Precision Machine Translation∗" pdf

Ngày tải lên : 20/02/2014, 12:20
... Norwegian text was gathered and translated by three professional translators Three quarters of the material are available for system development and also serve as training data for machine learning ... Using a trial LFG treebank for Norwegian (of less than 100 annotated sentences), we have adapted the tools for the current LOGON version and are now working to train on larger data sets and evaluate ... with varied domains of locality In total, there are around 300,000 features with non-trivial distribution, and we combine the MaxEnt model with a traditional language model trained on a much larger...
  • 4
  • 448
  • 0
MARINE PROTECTED AREAS: TOOLS FOR SUSTAINING OCEAN ECOSYSTEMS potx

MARINE PROTECTED AREAS: TOOLS FOR SUSTAINING OCEAN ECOSYSTEMS potx

Ngày tải lên : 06/03/2014, 18:21
... Washington, Seattle GRAEME KELLEHER, Great Barrier Reef Marine Park (consultant), Canberra, Australia STEVEN PALUMBI, Harvard University, Cambridge, Massachusetts ANA MARIA PARMA, Centro National Patagonico, ... international agreement are part of the Great Barrier Reef Marine Park and the Sabana-Camaguey Archipelago off the coast of Cuba These areas were declared to be “particularly sensitive sea areas” ... explicit management, particularly those with a relatively stationary adult stage A major constraint on implementation of spatial management is the lack of spatial catch data for many species and the...
  • 289
  • 343
  • 0
CAD tools for aesthetic engineering doc

CAD tools for aesthetic engineering doc

Ngày tải lên : 07/03/2014, 17:20
... parameters for optimization In this general approach, we can vary the methods for calculating the actual optimization moves, trading off accuracy for speed As a baseline for comparing the various ... this may not the easiest and most natural way for a designer to express herself or to approach a particular task In the early conceptual phases of design, the user interface plays a particularly ... engineering and are a main application for many industrial CAD tools Some surfaces are defined almost entirely by their functions; examples are ship hulls and airplane wings Other surfaces combine a mixture...
  • 14
  • 700
  • 0

Xem thêm