they can be used to pinpoint the high and low points resulting from two changing variables it can be helpful to think of a 3 d surface chart as a 3 d column chart which has had a rubber sheet stretched over the tops of the columns
Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt
Ngày tải lên :
12/08/2014, 23:21
... CCCAAAATCTGTAGCCATATGC TGCTTGTCTCCCCAGGGTAT CCCAAGAAAGATGGCTGGAA GGCAGGTCAGGTCAACAACA CGATGGCGTTTTTGAACAGAG CATCCAAGAAGCTTTCCTCAATCT AGTCAGAAATGCCTGCAAAAAGA TTCCTTGCCATGCGCGATCCC CGGATGTTGTGGAAAAACGA ... (line 13) and RJF First, a standard curve with a plasmid containing an env gene PCR product was made and used as an external standard for qPCR analysis (Fig 4A) The initial result revealed that three ... env277F/env353R pol197F/pol269R b* e* d* c* a* AGGTCATCACCATTGGCAATG GGGAAGCTTACTGGAATGGCT GCTACGGCGGCTTCATGA CGAAATGGAGACGGAACTGAA ACCCGGACATCACCCAAAG ACGGATTTCTGCCTCTCTACACA GAAACTACCTTGTGTGCTGTCG...
- 13
- 284
- 0
báo cáo khoa học: "The effect of crosses made in Tribolium castaneum between lines selected for high and low responsiveness to conditioned medium" pdf
Ngày tải lên :
09/08/2014, 22:23
... responsiveness, can be calculated from the equation : In a previous publication (L et al., 1978) we presented results of a selection AVIE program which was based on !, (3 , and was carried out on high and low ... mildlyconditioned and highly-conditioned The use of virgin females was in line with AMADA Y (1974), who showed that the genetic correlation between the egg laying of ROZCO virgin and fecund females ... should be looked upon independently of the other populations, a common feature of all the populations was that the response of the daughters of theY HR XLR cross was equal to or higher than that of...
- 5
- 284
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... still retained their names on the College Books; but many (39 ) were dead, and a still larger number had disappeared, and whither they had directed their steps it was no easy matter to ascertain When, ... belong to the University of Oxford, and one is a graduate of Cambridge To each of them I have addressed several communications, but hitherto without avail Another old Oar, though he has favoured me ... only died two or three years ago." Another of his fellow-oarsmen says: " D was a very fine oar, but he always gave me the idea of being an unsound man ; he was always pallid, and looked ghastly after...
- 419
- 541
- 0
Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc
Ngày tải lên :
23/03/2014, 00:20
... Preliminary judgment Land-take associated with an individual site is within the normal range of commercial and infrastructure developments in Europe, and it was judged that this can be considered as ... the surface as flowback and produced water – continues in many cases to flow to the surface from shale gas wells during the well completion phase and during the production phase of the well After ... rare and cumulatively the risks could be classified as moderate Effects on natural ecosystems during the gas production phase may arise due to human activity, traffic, land-take, habitat degradation...
- 292
- 586
- 0
Good Health to All: Reducing Health Inequalities among Children in High- and Low-Income Canadian Families potx
Ngày tải lên :
24/03/2014, 00:20
... years, the health and well being of Canadian children in low- income families has been identified as a policy priority, but policymakers need to have a clear understanding of the available tools to ... terms of both the amount and “quality” of time they spend with them and the material investment they make Quality of time with children is assumed to increase with parents’ education, perhaps because ... through the Canada Social Transfer (CST), and is provided on an equal per capita cash basis to ensure all Canadians have similar support regardless of their place of residence Including transition...
- 24
- 380
- 0
Báo cáo sinh học: "Egg production albino hens to high and low light intensities during brooding-rearing" ppsx
Ngày tải lên :
14/08/2014, 20:20
... During a 28-day period between 33 and 37 weeks of age, after the peak of laying, feed intake (0) was individually recorded together with egg mass (E), body weight variation (AW) and mean body weight ... (Mérat and Bordas, 1989) as regards an advantage of albino hens for egg production traits when they are given dim light as juveniles and bright light during the egg production period This advantage ... related to the numbers alive at 17 weeks of age were respectively 7/47 and 3/ 48 for colored and albino females at high light intensity, and 2/49 and 4/47 for the colored and albino females at low...
- 7
- 148
- 0
Tài liệu How to Think Like a Computer Scientist pptx
Ngày tải lên :
19/01/2014, 16:20
... name of the variable we pass as an argument has nothing to with the name of the parameter They can be the same or they can be different, but it is important to realize that they are not the same ... powerful features of a programming language is the ability to manipulate variables A variable is a named location that stores a value Values are things that can be printed and stored and (as we’ll ... did it at the beginning, middle or end So I started writing I wrote a chapter a day for 13 days, and on the 14th day I edited Then I sent it to be photocopied and bound When I handed it out on the...
- 298
- 528
- 0
Think Python How to Think Like a Computer Scientist potx
Ngày tải lên :
06/03/2014, 16:20
... speed and precision, and particular weaknesses, like lack of empathy and inability to grasp the big picture Your job is to be a good manager: find ways to take advantage of the strengths and mitigate ... use it as a calculator Python’s syntax for math operations is almost the same as standard mathematical notation For example, the symbols +, - and / denote addition, subtraction and division, as ... and it is On the other hand, there is a significant way in which string concatenation and repetition are different from integer addition and multiplication Can you think of a property that addition...
- 240
- 1.2K
- 0
EFFECTS OF TARIFFS AND SANITARY BARRIERS ON HIGH- AND LOW-VALUE POULTRY TRADE potx
Ngày tải lên :
08/03/2014, 09:20
... opportunities DATA The benchmark bilateral trade flows are obtained from the USDA International Bilateral Agricultural Trade Database that is adopted from trade data of the United Nations and contains ... Banned Allowed Banned Brazil Banned Allowed Banned Importers EU China Banned Allowed Allowed Allowed Allowed Banned Source: Authors’ review of trade-related regulations Japan Allowed Allowed Allowed ... Approaches, and Implications, November 2002 by Sudha Narayanan and Ashok Gulati 51 Rice Trade Liberalization and Poverty, November 2002 by Ashok Gulati and Sudha Narayanan 52 Fish as Food: Projections to...
- 49
- 438
- 0
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
Ngày tải lên :
08/03/2014, 23:20
... LqhaIT were performed using the following oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC -3 , 5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3 , and 5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG -3 , ... LqhaIT Finally, the third variable segment corresponds to residues 38 43, and includes three amino acids of the second LqhaIT b strand (34 39) and the following b turn Here also, BotXIV and a- insect ... efciency of the CNBr cleavage was estimated to 35 % (Fig 2, lanes and 4), and the products were puried by cation HPLC (data not shown) Recombinant chimera displayed an apparent kDa molecular mass as...
- 11
- 523
- 0
How to Think Like a Computer Scientist pot
Ngày tải lên :
14/03/2014, 15:20
... procedural and object-oriented programming And most importantly, it had to be easy to learn and teach When I investigated the choices with these goals in mind, Python stood out as the best candidate ... that students could use it at home regardless of their income I wanted a language that was used by professional programmers, and one that had an active developer community around it It had to ... size of the place to which they refer needs to be predetermined Thus, the idea of a variable is bound up with the hardware of the machine The powerful and fundamental concept of a variable is already...
- 280
- 513
- 0
Think Python: How to Think Like a Computer Scientist pptx
Ngày tải lên :
23/03/2014, 22:21
... that again: The name of the variable we pass as an argument has nothing to with the name of the parameter 3. 9 PARAMETERS AND VARIABLES ARE LOCAL 29 They can be the same or they can be different, ... can be as long as you want, although they can be difficult to read if they get out of hand One way to make them easier to read is to use standard indentation, as demonstrated in these examples ... language the AP exam is based on, as of 1998 Before that, the exam used Pascal Both C++ and Pascal are high- level languages; other high- level languages you might have heard of are Java, C and...
- 191
- 385
- 0
Think PythonHow to Think Like a Computer Scientist pot
Ngày tải lên :
28/03/2014, 22:20
... speed and precision, and particular weaknesses, like lack of empathy and inability to grasp the big picture Your job is to be a good manager: find ways to take advantage of the strengths and mitigate ... use it as a calculator Python’s syntax for math operations is almost the same as standard mathematical notation For example, the symbols +, - and / denote addition, subtraction and division, as ... and it is On the other hand, there is a significant way in which string concatenation and repetition are different from integer addition and multiplication Can you think of a property that addition...
- 240
- 1K
- 0
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
Ngày tải lên :
02/06/2014, 15:10
... 0802021117 TOPIC 13 By what means can a product or a servicebe advertised? Briefly present the strengths and weaknesses of each means A product or a service can be advertised by many means such as: ... of Coca cola TELEVISION WEAKNESSES The suppliers must pay high costs for Media Companies because their products advertised many times a day and many different channels In addition to payment ... WEAKNESSES Advertising leaflets can not create the trust for customers The customers usually receive the leaflets after that they throw away or if they read it but they can t remember information of the...
- 20
- 862
- 0
think java how to think like a computer scientist
Ngày tải lên :
13/06/2014, 16:20
... days, and on the 14th day I edited Then I sent it to be photocopied and bound When I handed it out on the first day of class, I told the students that they would be expected to read one chapter a ... creates variables named day, date, month and year day will contain the day of the week and date will contain the day of the month What type is each variable? Assign values to those variables that ... statement takes the value Math.PI, divides it by two and adds the result to the value of the variable angle The sum is then passed as an argument to cos (PI is the name of a variable, not a method,...
- 270
- 410
- 0
Forex Strategies for High and Low Volatility Markets_1 pptx
Ngày tải lên :
20/06/2014, 23:20
... Keep an economic calendar marked with the key release dates • Be aware of the major economic releases and the impact they can have • Stay abreast of major international developments and news as they ... away from Canada, the looney turned and was sold off, and the Canadian government cut interest rates accordingly Like a pendulum that has swung too far, it can be said that the weight of a stronger ... their Canadian counterparts because the cost of American feed and products was so much lower compared with the Canadian than it had been just three or four years earlier As business shifted away from...
- 32
- 306
- 0
Forex Strategies for High and Low Volatility Markets_2 docx
Ngày tải lên :
20/06/2014, 23:20
... will learn in Chapter that change -of- direction candles are used as trade signals It is important that as analysts and traders we understand that neither one of these candles means that a market ... preceding candle or candles Similarly, if the previous candles had developed a pattern of lower lows, lower highs, or lower closes, a change -of- direction candle would be a candle that closed above the ... see a hammer and then an inside bar, followed two candles later by a sharp change-ofdirection candle higher ahead of the weekend as longer-term, higher time frame traders take profits ahead of the...
- 32
- 190
- 0
Forex Strategies for High and Low Volatility Markets_6 pptx
Ngày tải lên :
20/06/2014, 23:20
... precursor to the Dow Jones Transportation Index It was widely believed that the Rails Average would lead the Industrial Average because before industries could expand, they had to purchase and transport ... perspective Rather than looking back over past activity to discern a trend, it is often far easier to glance at the MACD and see in an instant that it has closed definitively above or below the zero ... covered volume and the way it lends validity to breakouts and trending behavior They also covered sideways patterns, or what we’ve come to know as trading ranges Much of what the theory covered evolved...
- 32
- 207
- 0
Forex Strategies for High and Low Volatility Markets_7 docx
Ngày tải lên :
20/06/2014, 23:20
... and as long as 15 candles; the secondary trend, which can be as long as 15 to 60 candles; and the primary trend, which can be from 60 candles to hundreds It s also important to understand that ... Or a trader can decide to employ a countertrend strategy in which he uses support and resistance, individual candle behavior, and/ or a leading indicator to get in and out of trades faster In the ... intermediate-term, and long-term also are adjusted For trading, we define the three time frames as the short-term trend, which can be as short as two candles if price has closed beyond the last trendline...
- 32
- 265
- 0