there s a new kind of intelligence in town
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
Ngày tải lên :
22/03/2014, 18:20
... isotopologues make up a small fraction (10 s of ppm at most) of CO2 having natural stable isotope abundances, and so accurate analysis requires a virtual absence of isobaric interferences from contaminant ... involves 10 cycles of sample-standard comparison and each cycle involves s integration of sample and standard ion beams Analyses were standardized by comparison with an intra-laboratory reference gas ... apparatus used in this study Panel 1: System of vessels and purge gases used in the synthesis of calcite from bicarbonate solutions See text for explanation Panel 2: vacuum and carrier-gas apparatus...
- 18
- 472
- 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
Ngày tải lên :
18/02/2014, 00:20
... always symmetrical Parasitism has its place— perhaps a place of honor in symbiosis Tom Ray s work with Tierra as an artificial evolution system, for example, showed that parasites and meta-parasites ... Understanding the basic patterns and mechanisms of symbiosis and parasitism can provide both medical and organizational frameworks for global teams to cooperate in averting disasters and managing ... evolution of social superorganisms by suppressing cheaters and rewarding cooperators The organization of molecular processes into cells, of cells into multi-cellular organisms, and humans into human societies...
- 67
- 893
- 0
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
Ngày tải lên :
18/02/2014, 21:20
... taking action on sustainability, consumer goods CEOs see consumer demand as a critical factor, suggesting that leading companies see sustainability issues playing a larger role in shaping consumer ... feel may be coming from business-to-business customers—that is, the retailers Retailers pass on consumer pressure for transparency and sustainable operations, as well as the demand for sustainable ... programs aimed at embedding sustainability into every aspect of business, including supply chains, product design and innovation, marketing strategies and stakeholder relationships These instances,...
- 36
- 556
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
Ngày tải lên :
07/03/2014, 02:20
... Apoptosis in GFP+ (red) cells was assessed by annexin V staining and FACS analysis Nonstimulated cells are shown in gray The data shown are representative of three experiments (C) BJAB cells transiently ... increase in the amount of FADD in the cytoplasmic fraction of cells expressing wild-type CD95 (Fig 4D, lanes and 5) A similar increase in cytoplasmic FADD was also observed in CD95(Y291F)-expressing ... CD95-containing endosomal compartments, however, seems to require an activation loop involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling...
- 10
- 483
- 0
Stephen Wolfram - A New Kind Of Science Episode 12 doc
Ngày tải lên :
12/08/2014, 08:20
... CA classes, 235 Stationary phase approximation in path integrals, 1061 Statistical estimates in cellular automata, 953 Statistical fluctuations and shot noise, 968 Statistical independence and ... 1133 and discrete quantum mechanics, 1060 as systems based on constraints, 944 undecidability in, 1138 see also Ising model see also Lattice gases Spines on shells, 1008 Spinning as source of randomness, ... operations in, 1173 Latin squares and quasigroups, 1171 as satisfying constraints, 945 Lattice dynamical systems, 155-160, 922 see also Continuous cellular automata Lattice gases, 999 enumeration...
- 62
- 432
- 0
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot
Ngày tải lên :
10/08/2014, 21:24
... guidelines These are summarised in Tables and for both early and established disease Various recommendations are made for inclusion of podiatrists in the multidisciplinary care team, access to ... such an approach is lacking, but the area has been identified as a research priority A new paradigm for podiatrists focuses on combination therapy targeted at inflammatory lesions and associated ... medical care Musculoskeletal foot health assessment should include: General health; Foot health; Systemic factors; Lifestyle/Social factors; Pain management; Need for other assessments as required...
- 10
- 383
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... (đúng Cồn Ngao) thuộc s ng Tiền Đònh An, Ba Thắc, Trần Đề (s thực Trấn Di) thuộc s ng Hậu [theo 66; 367] Hệ thống s ng Đồng Nai với mạng lưới s ng nhánh dày s ng La Ngà, s ng Bé, s ng S i Gòn… ... ăn cá, đồng ăn cua” (ca dao) Đời s ng dân chúng dễ chòu, lo ăn mặc: “Thành Gia Đònh Việt Nam ta, đất rộng lương thực nhiều, không lo đói rét, ch a s n, tục dân sa hoa, kẻ s đua tài giỏi Người ... giao thoa, vay mượn, chí đồng hoá s yếu tố ngôn ngữ Trong nghiệp mở mang, khai phá vùng lãnh thổ ph a nam Tổ quốc, người Việt từ vùng đất sinh s ng lâu đời mang theo nét văn hoá, đời s ng tinh...
- 137
- 853
- 0
MEED S.A. The Costs of Water Pollution in India potx
Ngày tải lên :
06/03/2014, 15:21
... in favour of SSIs may be increased in some cases when an industrial area gathers SSIs as well as larger polluting industries In these case, some cross subsidies may be set up by asking the larger ... Rivers and Lakes, India, 1997 and 2000 State/Union Territory Andhra Pradesh Assam Bihar Goa Gujarat Haryana Himachal Pradesh Jammu and Kashmir Karnataka Kerala Madhya Pradesh Maharashtra Orissa ... Output intensity States Bihar Madhya Pradesh Maharashtra Orissa Andhra Pradesh West Bengal Uttar Pradesh Punjab Tamil Nadu Gujarat Karnataka Haryana Rajasthan Delhi Pondicherry Chandigarh Assam Pollution...
- 55
- 933
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
Ngày tải lên :
14/03/2014, 23:20
... TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC ... primers were as follows: PPP6C sense and PPP6C antisense as above; b-actin sense, 5¢-CGTGACATTAAGGAGAAGCTG-3¢; and b-actin antisense, 5¢-CTAGAAGCATTTGCGGTGGAC-3¢ PCR cycles were as follows: 94 ... was assessed by enhanced chemiluminescence and exposure to chemiluminescent film lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased...
- 11
- 396
- 0
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
Ngày tải lên :
23/03/2014, 06:20
... chromatogram using the same criteria as for ADP and inosine Enzyme assays and identification of reaction products Enzyme assays The AMP–AMP phosphotransferase assay mixture contained 4.0 mm cold AMP ... component, showing the purity grade of the protein The molecular mass of the sample was calculated by the processing software associated with the mass spectrometer to a mass accuracy of 0.01%, and can ... and processed using masslynx software (Micromass) Mass scale calibration was performed with multiply charged ions from a separate injection of horse heart myoglobin (average molecular mass, 16 951.5...
- 15
- 378
- 0
philosophy in the modern world a new history of western philosophy volume 4 jun 2007
Ngày tải lên :
11/06/2014, 10:25
... a time Bentham s reputation was greater in France than in Britain Bentham spent the years 1785–7 abroad, travelling across Europe and staying with his brother Samuel, who was managing estates ... ruling and oppressed classes; the history of these class struggles forms a series of evolutions in which, nowadays, a stage has been reached where the exploited and oppressed class—the proletariat—cannot ... published a pamphlet advocating a radical reform of the landholding system He advocated proportional representation in parliamentary elections, as a safeguard against the exercise of tyranny by a majority...
- 364
- 422
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
Ngày tải lên :
18/06/2014, 15:20
... Journal of Translational Medicine 2009, 7:46 Dr Mariz Vainzof for WB analysis and suggestions; Dr Irina Kerkis for antibodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for ... Results of hFTs lineage in passage two Panel B) Results of hFTs lineage in passage 11 We observed high rates of cell division, with gradual decreasing of the population doubling time (PDT) in lineages ... an integrin involved in cell adhesion was also greatly expressed in all htMSCs studied lineages, including freshly digested samples Curiously, according to evidences from recent studies, this...
- 10
- 456
- 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
Ngày tải lên :
18/06/2014, 22:20
... organization of inteins and C-terminal autocatalytic domains Protein Sci 1998, 7:64-71 Amitai G, Dassa B, Pietrokovski S: Protein splicing of inteins with atypical glutamine and aspartate C-terminal residues ... comprehensive list) For instance, they are relatively abundant in some hyperthermophilic archaea species (such as Methanococcus jannaschii possessing nineteen inteins), but absent in closely related species ... Mimivirus intein and other PolI inteins also supports the classification of the Mimivirus intein in this specific "intein allele"-type (Fig 1C) This underlines the presence of intein subclasses ("intein...
- 7
- 435
- 0
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx
Ngày tải lên :
20/06/2014, 00:20
... profile as a standard As a next step, we set out to discover the properties of each of the profiles We used a new type of classification, "axial coding" [21], consisting of intense analysis focused ... constructiva y teor a social (Spanish translation of Constructive typology and social theory) Buenos Aires: Amorrortu; 1966:23 Vall s MS: Técnicas Cualitativas de Investigación Social Madrid: S ntesis Sociolog a; ... the semiotic square is a basic instrument of semiotic study and serves for the development of typologies Abril [23] speaks of the semiotic square as a canonical representation of a set of relations...
- 17
- 604
- 0
báo cáo hóa học:" A new example of viral intein in Mimivirus" potx
Ngày tải lên :
20/06/2014, 04:20
... organization of inteins and C-terminal autocatalytic domains Protein Sci 1998, 7:64-71 Amitai G, Dassa B, Pietrokovski S: Protein splicing of inteins with atypical glutamine and aspartate C-terminal residues ... comprehensive list) For instance, they are relatively abundant in some hyperthermophilic archaea species (such as Methanococcus jannaschii possessing nineteen inteins), but absent in closely related species ... Mimivirus intein and other PolI inteins also supports the classification of the Mimivirus intein in this specific "intein allele"-type (Fig 1C) This underlines the presence of intein subclasses ("intein...
- 7
- 321
- 0