there is a lack of confidence
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx
Ngày tải lên :
26/01/2014, 04:20
... situations. To mask some of the noise at low light
levels, consumer cameras often use a setup, or black level, of zero IRE,
rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... the same color temperature.
A combination of filters and electronic adjustments is used to adapt color
cameras to each new lighting situation. Most cameras can adjust
automatically to typical ... cameras. 2 LUX is
equal to .19 foot candles. 4 LUX is about .37 foot candles. I was suspicious,
so a number of years ago I set up an ordinary candle one foot away from a
white square on a black...
- 6
- 462
- 1
Learning english is a piece of cake 1
Ngày tải lên :
27/01/2014, 20:11
... raɪz nju
ː
w
ɜːdz
and grammatical rules. In fact, learning English can be a piece of cake.
ənd ɡrə ˈmæt ɪk əl ru
ːlz
ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn bi
ː
ə pi
ːs
ʌv keɪk
Don’t worry about ... worry about pronunciation. Don’t worry about grammar.
doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə
Don’t be afraid of making mistakes. Just try to speak.
doʊnt bi
ː ə ... http://langmaster.edu.vn | Crazy English Trainers: WaNo: 01653.994.122 | Chuẩntt : 0985.82.87.87
In fact, she is a sales person!
7. “Improve” = cải thiện, cải tiến.
I want to improve...
- 2
- 1.7K
- 15
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
Ngày tải lên :
07/03/2014, 03:20
... CGCTTTCGGAGGTGCTTTCGCAG
M1941p65.R: TCAGAGTTCCCTACCGAAGCAG
P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA
M225PO.P: CCGTGGTGCTGATGGGCAAGAA
M267PO.R: ACCATGATGCGCAAGGCCAT
p21
WAF1/CIP1
Cyclin-dependent ... inverted terminal repeat amplification were:
1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT
A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC
ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT
Table 1. Primers and probe sets ... A & Kandarian
SC (2003) Global analysis of gene expression patterns
during disuse atrophy in rat skeletal muscle. J Physiol
551, 33–48.
12 Aihara Y, Kurabayashi M, Saito Y, Ohyama Y,
Tanaka...
- 16
- 428
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
Ngày tải lên :
07/03/2014, 12:20
... [e.g.
cerato-platanin of Ceratocystis fimbriata f. sp. platani,
Snodprot1 of Phaeosphaeria nodorum and Sp1 of
Leptosphaeria maculans) or human allergens and path-
ogenesis-related proteins (As-CG of ... Stability of
clades was evaluated by 1000 bootstrap rearrangements.
Bootstrap values lower than 20% are not displayed in the
cladogram.
RNA isolation and hybridization
Fungal mycelia were harvested ... helices, separated by a 14
amino acid strand.
interproscan analysis [22] of Epl1 showed the affi-
liation of this protein to the cerato-platanin family
(IPR010829). This is a group of low molecular weight,
4-cysteine-containing...
- 14
- 494
- 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
Ngày tải lên :
25/10/2012, 10:31
... significant at a 10% level in the univariate analysis and
subjected to multivariate Cox regression analysis: lactate,
APACHE II score, SOFA score and circulating Ang-2 (Table
2). Except for Ang-2 ... optimal cut-off values. Data are displayed as
median and range (minimum to maximum) unless otherwise
stated. All statistical analyses were performed with the SPSS
Table 1
Demographic, clinical and ... Systems,
Minneapolis, USA). This assay measures biologically active
VEGF
121
and VEGF
165
.
Statistical analysis
Differences between patients and healthy controls were eval-
uated using a non-parametric...
- 9
- 634
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
Ngày tải lên :
25/10/2012, 10:35
... 51:189-197.
27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-
dation of a behavioral pain scale in critically ill, sedated, and
mechanically ventilated patients. Anesth Analg 2005,
101:1470-1476.
28. ... in the acquisition of data and
the study design. JB participated in the acquisition of data. NM
helped to draft the manuscript, and participated in the acquisi-
tion of data. AZ participated in ... the analyzer Cobas Integra (Roche
Diagnostics, Mannheim, Germany). The limits of detection
were 0.071 mg/dl.
Statistical analyses
Data are presented as the mean ± standard deviation for vari-
ables...
- 10
- 597
- 0
How Is the Ku Klux Klan Like a Group of Real-Estate Agents
Ngày tải lên :
17/10/2013, 18:20
... blacks. An analysis of more than 160 episodes
71
The Ku Klux Klan and Real-Estate Agents
had learned via his own investigations, he probably knew more Klan
secrets than the average Klansman. ... either a fabulist, a narcissist, or simply re-
sistant to the meaning of “average.” (Or perhaps they are all just prag-
matists: as any real-estate agent knows, the typical house isn’t
“charming” ...
cognizant of his discrimination toward Latinos and the elderly (or, in
the case of blacks and women, his lack of discrimination). He is
bound to be nervous, after all, and excited, playing a fast-moving...
- 30
- 550
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
Ngày tải lên :
20/01/2014, 20:20
... than, a decade ago.
(A) equally as prevalent, if not more so than, a decade ago.
(B) equally as prevalent, if not more so than, it was a decade ago.
(C) as prevalent, if not more than a decade ... duplicate com-
pared to the cost of developing and marketing the software. The
actual cost of duplicating a software program, which may have
a retail value of $400 or more, can be as little as a ... as any candidate in the state’s
history.
(B) she had been reelected with as wide of
a margin as any candidate in the
state’s history.
(C) having been reelected with as wide a
margin as any candidate...
- 696
- 1K
- 1