the three tier client server architecture consists of a client an object and a data source

Đề tài " Existence and minimizing properties of retrograde orbits to the three-body problem with various choices of masses " potx

Ngày tải lên : 29/03/2014, 07:20

... variational approach with a mixture of topological and symmetry constraints The advantage of our approach, as Figure indicates, is that it applies to a wide range of masses In sharp contrast with the ... Following a standard argument in the calculus of variations, the action functional A attains its inﬁmum on Hφ Although it may appear as an easy fact, let us remark here that collision∗ free critical ... Alain Chenciner, and the referees for valuable comments Many thanks to Don Wang and Maciej Wojtkowski for enlightening conversations and their hospitality during my visit to the University of Arizona...

25
286
0

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

Ngày tải lên : 16/03/2014, 00:20

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classiﬁed as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully ... present any activity on thiamin degradation Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial genomes was performed...

9
491
0

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Ngày tải lên : 20/06/2014, 01:20

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript, ... nucleotide mutation at the 3' end of the primer binding site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine...

4
329
0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

Ngày tải lên : 20/06/2014, 04:20

... versions of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the ... interpretation of the data and drafted the earlier versions of the manuscript ME, KC, AS, MB made substantial contributions to the interpretation of the data and revised the manuscript critically ... University, Hamilton, Ontario, L8S4L8, Canada Authors’ contributions SSP conceived the idea, made substantial contributions to the analysis and interpretation of the data and drafted the earlier versions...

7
443
0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf

Ngày tải lên : 20/06/2014, 07:20

... versions of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the ... interpretation of the data and drafted the earlier versions of the manuscript ME, KC, AS, MB made substantial contributions to the interpretation of the data and revised the manuscript critically ... University, Hamilton, Ontario, L8S4L8, Canada Authors’ contributions SSP conceived the idea, made substantial contributions to the analysis and interpretation of the data and drafted the earlier versions...

7
507
0

Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt

Ngày tải lên : 21/06/2014, 05:20

... Banach spaces,” Optimization Letters In press 26 A Tada and W Takahashi, “Weak and strong convergence theorems for a nonexpansive mapping and an equilibrium problem,” Journal of Optimization Theory ... of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 P Hartman and G Stampacchia, “On some non-linear elliptic diﬀerential-functional equations,” Acta Mathematica, vol 115, ... Recovery: Theory and Application, H Stark, Ed., pp 155–270, Academic Press, Orlando, Fla, USA, 1987 38 Y Censor and S A Zenios, Parallel Optimization, Numerical Mathematics and Scientiﬁc Computation,...

25
495
0

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Ngày tải lên : 22/06/2014, 22:20

... elevated temperature The shape and size tunability of SnS NCs can be achieved by controlling the reaction temperature and time, and the nature of stabilizing ligands HRTEM investigation and XRD analysis ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum conﬁnement ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

5
365
0

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Ngày tải lên : 22/06/2014, 22:20

... elevated temperature The shape and size tunability of SnS NCs can be achieved by controlling the reaction temperature and time, and the nature of stabilizing ligands HRTEM investigation and XRD analysis ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum conﬁnement ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

5
276
0

LUYỆN ĐỌC ANH NGỮ QUA CÁC TÁC PHẨM VĂN HỌC-THE THREE MUSKERTEERS ALEXANDRE DUMAS CHAPTER 48 48. A Family Affair Athos had invented the docx

Ngày tải lên : 02/07/2014, 03:20

... his arm, and went out Porthos and Aramis remained behind to encounter the jokes of the dragoon and the Swiss As to Bazin, he went and lay down on a truss of straw; and as he had more imagination ... inquired Aramis “D’Artagnan and I Or rather, to observe the chronological order, I and D’Artagnan,” replied Athos And does the husband of this frightful creature still live?” said Aramis “He ... contained half a line, in a hand perfectly British, and with a conciseness as perfectly Spartan: Thank you; be easy D’Artagnan translated this for the others Athos took the letter from the hands...

29
165
0

information in this document is subject to change without notice. the names of companies, products, people, characters,

Ngày tải lên : 06/07/2014, 09:03

... hired at NWTraders Corporation, the HR manager sends an e-mail message to the HR SQL database administrator, the e-mail administrator, and the network administrator, to request that a user object ... accounts in the appropriate role lists: directory administrators, operators, and security officers Then assign the necessary permissions to the administrative areas that contain the data managed ... ensure cleaner data in their directories? None of them More than likely, the data in each of these directories would not be very clean Without adequate and enforced corporate guidelines and naming...

24
495
0

Báo cáo y học: "Turning up the volume on mutational pressure: Is more of a good thing always better? (A case study of HIV-1 Vif and APOBEC3)" pot

Ngày tải lên : 13/08/2014, 06:20

... Wildtype Codon APOBEC3G Target APOBEC3F Target ATG(G) GAC CAG(G) ATG(G) TTG (A) GAG (A) GGA ATG(G) + + + + + Observed Mutant Codon Mutant Frequency ATA na CAA× ATA* TTA× AAG* AGA ATA 0.7 0.5 0.6 0.1 0.3 ... structure of HIV-1 and the distribution of APOBEC3G and APOBEC3F target sequence motifs across the HIV-1 proteome APOBEC3G and APOBEC3F principally target "GG" (GG->AG) and "GA" (GA->AA) dinucleotides, ... The monomeric capacity of APOBEC3G makes the range of 3–11 molecules per virion meaningful, and likely consequential [28,29] HIV-1 can tolerate an elevated mutation rate, and a true upper limit...

8
383
0

Báo cáo y học: " Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin " pot

Ngày tải lên : 13/08/2014, 19:20

... Organism Candida albicans only versus non-albicans Candida C albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata versus other Candida spp Candida parapsilosis versus other Candida spp ... B-treated subjects and across the ICU and non-ICU subgroups (Table 3) Overall and across the analysis groups, a non-albicans Candida species was more frequently isolated at baseline than Candida albicans ... mg/kg/day Age (years) Continuous Sex Female Region Brazil, Europe, India, North America Male Other Race Caucasian Asian-Indian Black Other Primary diagnosis Candidemia Disseminated candidiasis Organism...

10
378
0

Appropriate methods in determining the event mean conce pollutant removal efficiency of a best management practice ntration and

Ngày tải lên : 11/10/2014, 02:19

... mm of rainfall The EMC for each pollutant was calculated for each event and then categorized for each of the rainfall ranges Finally, the overall EMC was computed and compared with that of the ... Greenberg AE, Clesceri LS, Eaton AD, American Public Health Association (APHA), American Water Works Association, Water Environment Federation Standard methods for the examination of water and wastewater ... The sum of the maximum rainfall for each year over a three year period was about one-third of the total rainfall over three years Table provides the rainfall data used in the calculation of the...

9
232
0

Proof of the orthogonal measurement conjecture for two states of a qubit

Ngày tải lên : 14/09/2015, 08:37

... for random, correlated data for Alice and Bob The idea is a small variation to the idea laid out before Alice and Bob agree on a number of different encoding schemes beforehand Each typical sequence ... valued measures It has direct application in the theory of channel capacities and quantum cryptography The mutual information measures the amount of classical information transmitted from Alice ... introduction to the physical and informational motivation of the mutual information The results are well known and can be found in any standard textbook, e.g [3] The mutual information arises from the question,...

100
345
0

the american practical navigator table 7 length of a degree of latitude longitude

Ngày tải lên : 09/05/2016, 08:53

1
129
0

How Do Earnings Change When Reservists Are Activated - A Reconciliation of Estimates Derived from Survey and Administrative Data docx

Ngày tải lên : 23/03/2014, 02:20

... administrative data as the sum of civilian earnings, military earnings (pays and allowances), and any tax advantage of military compensation (see immediately below for an explanation) The earnings change ... writing analysis programs, and facilitating data transfer to and from DMDC and SSA His assistance on this and other projects related to the earnings of reservists has been instrumental and we thank ... survey and administrative data include Goldman and Smith (2001), Denmead and Turek (2005), Hurd and Rohwedder (2006), Kapteyn and Ypma (2007), and Haider and Loughran (2008) None of the estimates...

74
228
0

City of St. Catharines STORMWATER MANAGEMENT AND NON-POINT SOURCE RUNOFF Mayor Tim Rigby potx

Ngày tải lên : 29/03/2014, 14:20

... km Lake Ontario Beaches and 25 km (16 mi) Lake Ontario waterfront Watercourses: 120 km (75 mi) Three major waterways: Welland Ship Canal, Twelve Mile Creek and the Old Welland Canal 25 urban creeks ... erosion NATURAL ENVIRONMENT Sufficient water of a satisfactory quality in natural settings to restore and maintain healthy flora, fauna and ecosystem integrity AGRICULTURE AND COMMERCE Clean and abundant ... Strategy HUMAN HEALTH Clean and abundant drinking water for safe human consumption PROPERTY RISK AND LIABILITY Protection for residential, employment and public land uses from adverse flooding and...

30
239
0

mathematical foundations of scientific visualization, computer graphics, and massive data exploration [electronic resource]

Ngày tải lên : 29/05/2014, 17:20

... display all the data: image-space projection and T M¨ ller et al (eds.), Mathematical Foundations of Scientiﬁc Visualization, Computer o Graphics, and Massive Data Exploration, Mathematics and ... a as the union of a and all integral lines that start at a If no integral line starts and ends at a saddle, see [9], we can overlay these two complexes and obtain what we call the Morse–Smale ... visualization algorithms break down for very large data sets While standard approaches use multiresolution data structures, approximations, and visualization paradigms, peta-size data sets cannot be handled...

348
269
0

Báo cáo y học: "Primary care use of antipsychotic drugs: an audit and intervention study" ppt

Ngày tải lên : 08/08/2014, 21:20

... the usage and cost of conventional and depot medications remained constant, the usage and cost of atypical antipsychotic drugs, particularly olanzapine and risperidone, increased substantially ... GPs had agreed to their being approached The mean age of the patients was 59 years, with a range of 62 years: the oldest patient was 95 and the youngest patient was 33 15 patients were men and ... Scale (QLSAS) [24] Basic demographic and clinical data were collected: age, sex and clinical diagnosis from GP notes and the interview At follow-up after a clinically appropriate period, patients'...

8
464
0

$characterization of fracture reservoir using static and dynamic data$

characterization of fracture reservoir using static and dynamic data

Ngày tải lên : 04/10/2014, 22:10

86
189
0