... directly.Stimulation ofthe effector causes a contraction ofthe corresponding muscle or the stimulation ofthe activity ofthe appropriate gland. We shall call the state of all receptorsat a certain moment ... ONE The Initial Stages of Evolution THE BASIC LAW OF EVOLUTIONIN THE PROCESS ofthe evolution of life, as far as we know, the totalmass of livingmatter has always been and is now increasing and ... the process of evolution? We have seen that the appearance of hierarchicallyorganizedclassifiers can be explained as a result ofthe combined actionof two basic evolutionaryfactors: replication...
... three parts, the ego (the rational, cognitive part), the id (the irrational, emotional part), and the superego 2 THE GRAVITY OF WEIGHTas a disease has many advantages and benefits, including garnering ... the brain, of course, and not a separate anatomical struc-ture. We have ideas about what parts ofthe brain contribute to our notion of mind, but we have yet to identify exactly what we mean by ... most of his nonobese friends, many of whom had actually died years before.My father had several ofthe risk factors that often lead to an earlier death, including chronic heart disease, abdominal...
... about it, then lays out an example of code that makes sense—whether you’re a seasoned programmer or entirely new to JavaScript. On top of all that, he takes a practical approachto programming, ... JavaScript’s ability to read what a visitor has entered into a form, perform a mathematical calculation based on the input, and provide feedback by displaying the results in another part ofthe form. ... to know to create Ajax applications.Chapter 15: XML in JavaScript and Ajax The X in Ajax stands for XML. This chapter describes how to represent information using the XML data-sharing standard...
... wrote Java as a general programming language that works on all kinds of operating systems. As you’ll see in Appendix A , though JavaScript can talk to Java programs, they’re two totally separate ... Thus the line var browser_version = parseFloat(navigator.appVersion); sets the variable browser_version tothe version number ofthe visitor’s browser. Together, navigator.appName and navigator.appVersion ... from recalcitrant engineers. Java Although JavaScript and Java have similar names, they aren’t the same. Netscape initially created JavaScript to provide interactivity for Web pages, and Sun...
... Combinatory grammars and parasitic gaps. Natural Language and Lin- guistic Theory, 5:403-439. Mark J. Steedman. 1989. Constituency and coor- dination in a combinatory grammar. In Mark Baltin ... that has advantages over the widely-assumed account of Partee and Rooth (1983). Here we have separated the issue of arriving at the appropriate f-structure in thesyntax from the issue of ... Lamping, Fernando C. N. Pereira, and Vijay Saraswat. 199 4a. A de- ductive account of quantification in LFG. In Makoto Kanazawa, Christopher J. Pifi6n, and Henriette de Swart, editors, Quantifiers,...
... Experi-mental procedures, the rate of assimilate export fromphotosynthetically active source organs to consumingsink organs or metabolic pathways other than carbo-hydrate pathways was calculated as the ... distribution of plants. During the so-called process of coldacclimation, many plants are able to develop low-temperature tolerance,associated with the reprogramming ofa large part of their metabolism. ... parameter identificationand simulation A mathematical model was developed, representing centralcarbohydrate metabolism in leaves of A. thaliana. The model was based on the following system of...
... McNabb entered a second career in academia. He advanced tothe rank of professor on the faculty at Pacific Lutheran University. He has a BA from California State College at Fullerton, an MA from ... unwillingness of managers or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking. Failure or inability of an agen-cy’s management or staff to adapt to changed conditions ... Only then can they integrate the new way of operating into the organization’s culture.External causes of an organizational crisis can spring from any ofthe uncontrol-lable factors that result...
... activities of the organisation. Risk management enhances the understanding ofthe potential upside anddownside ofthe factors that can affect anorganisation. It increases the probability of success and ... undertakes appropriate risk reviews.Other features of learning from experience includeevaluation of audit reports and an assessment of the sources of risk assurance available to the Board and the audit ... within the analysis organisation to identify critical components that are key to success ● HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes EffectsAnalysis are quantitative...
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... MR-1R was used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right ofthe agarose gels. (B) Visualization and separation of high...
... give an illustration ofthe behavior ofthe morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central tothe task ofa morphological analyzer and, hence, have incorporated...
... substances.Indicator: Global atmospheric concentrations of CFC-U and CFC-12.Indicator: Stratospheric ozone levels over Canada.Further indicators may be introduced at a laterdate to measure ... sustainability of land useand land management practices should find thesemaps invaluable. At any rate, efforts to developsuch map-based indicators of ecosystem risk canserve several information ... be the lastword on this new field. On the contrary, it deliber-ately proposes bold ideas to spark dialogue onwhich data to compile and how to massage a mass of facts into a handful of meaningful...
... Italian), pastarant (pasta + restaurant)and peatza (pizza + eat). These three suggestions areamusing and have a nice ring to them. As a matter of fact, it turns out that the name Eatalian is actuallyused ... eating), pizza and pasta(which are found AtLocation restaurant) to generatean appropriate name. The three “palatable” neolo-gisms generated are eatalian (from the combination of eat and Italian), ... Computational Linguistics A Computational Approachtothe Automation of Creative NamingG¨ozde¨OzbalFBK-Irst / Trento, Italygozbalde@gmail.comCarlo StrapparavaFBK-Irst / Trento, Italystrappa@fbk.euAbstractIn...
... frequency parts ofthe vocal range and the angular frequencies to( F) and amplitudes a( F) of formants. The first four cues dp, to {h are properties ofa single spectral slice, and the change in these ... traditional ASR applications (e.g. dictation, database access), but also embraces multilingual speech input, medical (speech therapy) and teaching (computer-assisted language learning) applications. ... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal). These elements are phonologically active - they can spread to neighbouring...
... not only the Messiah and the Son of God but also the Son of Man who will be seated at the righthand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... the ritual ofthe Day of Expiation.1 John may also have in mind the ceremony on the Day of Expiation, when it speaks of Christ as the hilasmos (means of expi-6See D. P. Wright, ‘Day of Atonement’, ... blessed and brokeit, and gave it to them, and said: “Take, this is my body.” And he took a cup, and when he had given thanks he gave it to them, and they alldrank of it. And he said to them,...