the role of short term memory in visual attention pages 610 617 gustavo deco and edmund t rolls pdf

Short term memory in english to vietnamese consecutive interpreting

Short term memory in english to vietnamese consecutive interpreting

Ngày tải lên : 17/12/2013, 20:37
... structure is to demonstrate the aspects of the theme: the role of short- term memory, the relation between short- term memory and English to Vietnamese consecutive interpreting and the suggestions to improve ... need to pay attention more to practice short- term memory According to the collected data, it reveals that students haven t paid enough attention to practice short- term memory Therefore, they ... skill In order to obtain the greatest findings and enhance the effectiveness of the study, it is scoped with short- term memory in English to Vietnamese consecutive interpreting” Methods of the study...
  • 62
  • 565
  • 3
Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Ngày tải lên : 21/02/2014, 01:20
... sources of innovation that can provide the impetus for economic development Applying knowledge and forming intellectual capital Nearly two-thirds of National Association of State Universities and Land-Grant ... Collaboration with Other Educational Institutions Partnerships with local and regional educational providers Workforce Development and Training Programs that train students/employees for the workforce ... faculty, staff, student and visitor spending adds to the local economy Universities provide a major stimulus to their state and regional economies, including generating an average return of up to...
  • 29
  • 654
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Ngày tải lên : 22/02/2014, 04:20
... ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the EcoRI restriction site ... enzyme) Interestingly, the activity of the mutant at elevated temperatures (20–25 °C) exceeded that of the wild-type protein Further substitution of His135 by Asp in the triple mutant W260K/A219N/H135D ... attributed to the presence of the Gly cluster in this element The present study supports the idea that the Gly cluster, in combination with its structural environment, is an essential feature of the...
  • 6
  • 488
  • 0
Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Ngày tải lên : 07/03/2014, 12:20
... ACAAAAAYMGSRCRAATCTCCTCRGCTCCTGRTCW AKTATGCTTCCCAGTCCATCTCT-3¢) and g7EcoFor (5¢-AGTGAATTCTCATCTTTGACCCCCAGCGATTAT ACCAA-3¢) As a linker to connect these two, a DNA encoding H49 to L39 with intervening sequences ... Scattered plot of VH and VL interaction against relative affinity of the Fv to the antigen The plot is classified by the type of H39, as indicated Fig Scattered plot of OS-fitness against relative ... noncovalently interacting C-terminal constant domains While Fv and its derivatives are widely used, to date no attempt has been made to clarify the effect of the interface mutations on the antigenbinding...
  • 11
  • 462
  • 0
Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Ngày tải lên : 08/03/2014, 05:20
... of the systems participating in the TREC evaluation In addition, TREC-9 imposed the constraint that an answer is considered correct only when the textual context from the document that contains ... Portugal into the Hawaiian islands contains two named entities of the category L O CATION and both are marked accordingly Step 2: The identication of the question concepts The second step identies ... semantic alternation Sometimes these alternations are similar to the relations between multiterm paraphrases and single terms, other time they simply are semantically related terms In the case of...
  • 8
  • 508
  • 0
Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

Ngày tải lên : 14/03/2014, 14:20
... only the direction of the relation is considered, congruity theorists consider both the direction and magnitude of the relation Focusing on the strength of the relation also draw attention to the ... subsequent effect on relationship realignment and changing brand attitudes To obtain this purpose, it is suitable to use the qualitative data collection method, in- depth interview In addition, the ... makes recipient ambivalence Gift giving situation Gift situation might affect to recipient’s emotions and attitude in different aspects As a starting point for a definition, most theoreticians would...
  • 10
  • 482
  • 0
Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

Ngày tải lên : 16/03/2014, 14:20
... for evaluating the role of Glc6P, we determined the effect of different inhibitor concentrations on the Glc6P content and the rate of glycogen synthesis in hepatocytes incubated with 15 mm glucose ... effects from studies of glucokinase overexpression [29,30] The aim of the present study was to provide a better understanding of the contribution of Glc6P to the metabolic effects of glucokinase ... affect the total glucokinase activity, suggesting that changes in protein expression are minimal within this time scale S4048 also did not affect the distribution of glucokinase between the nucleus...
  • 11
  • 503
  • 0
Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Ngày tải lên : 17/03/2014, 04:20
... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... classification To better understand this issue, we again examine a number of test documents Our initial investigation suggests that the problem might have stemmed from the fact that MINIPAR returns ... subsection suggest that our method for extracting objective materials and removing them from the reviews is not effective in terms of improving performance To determine the reason, we examine the...
  • 8
  • 489
  • 0
Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

Ngày tải lên : 22/03/2014, 16:21
... the terminal or subterminal position Surprisingly, CYP1 and CYP2 share only 15% amino acid identity and despite their activity towards the terminus of fatty acids, they are not classified into the ... oxidation Although cytochrome P450s not intervene in the degradation of fatty acids in the b-oxidation cycle itself, they take part in the steps preceding b-oxidation (Fig 1) As mentioned in the ... required for breaking the plant’s defence but, on the other hand, alkanes serve as nutritional input during the initial colonization steps Insect cuticle consists of protein and chitin, and is covered...
  • 16
  • 564
  • 0
The Role of Interest Rate Swaps in Corporate Finance doc

The Role of Interest Rate Swaps in Corporate Finance doc

Ngày tải lên : 22/03/2014, 17:20
... outstanding At the start of each period this firm refinances its debt at the prevailing short- term interest rate, rb (t) If short- term market interest rates are volatile, then the firm’s financing ... fixed-rate obligation to a synthetic floating-rate note The net period t cost of this synthetic note is just the cost of its fixed-rate obligation plus the net cost of the swap: Period t cost of synthetic ... volatility in U.S market interest rates, leading them to attribute the rapid growth of interest rate derivatives to the desire on the part of firms to hedge cash flows against the effects of interest...
  • 20
  • 387
  • 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

Ngày tải lên : 22/03/2014, 18:20
... barrier of unfolding DGu The distance to the transition state, Dxu, determines the sensitivity of the unfolding rate to the pulling force and measures the elongation of the protein at the transition ... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A’ (Y9) and the last amino acid of strand ... A and B b-strands near the amino terminus of the protein domain causes an initial extension of the protein, before the unfolding transition state is reached.[53] The hump observed both in the...
  • 12
  • 553
  • 0
The Role of Digital Identity Management in the Internet Economy doc

The Role of Digital Identity Management in the Internet Economy doc

Ngày tải lên : 23/03/2014, 23:21
... relates to the problem of determining liability for these complex business relationships and protecting against theft and errors The main vulnerabilities stem from the fact that the identity provider ... identities, with a view to strengthening confidence in the online activities crucial to the growth of the Internet Economy The primer is a product of the Working Party on Information Security and ... for the Future of the Internet Economy” (2008), available at: www.oecd.org/futureinternet The use of the term “Internet” is intended to be broad, and reflect the convergence of digital networks,...
  • 22
  • 503
  • 0
Báo cáo khoa học: Membrane compartments and purinergic signalling: the role of plasma membrane microdomains in the modulation of P2XR-mediated signalling pot

Báo cáo khoa học: Membrane compartments and purinergic signalling: the role of plasma membrane microdomains in the modulation of P2XR-mediated signalling pot

Ngày tải lên : 30/03/2014, 02:20
... conditions The fact that the raft fractions obtained by the detergentfree method preserved all the biochemical and biophysical properties argues in favour of an effect of the detergent on the interaction ... domains (adaptins, transferrin receptor) Another way to study the role of lipid rafts is to analyze the impact on cell functions of the manipulation of their constituents Methyl-b-cyclodextrins, which ... detergent-based methods can abolish the interaction of proteins weakly associated with lipid rafts or provoke the loss of raft proteins that also tightly bind to cytoskeletal components The detergent...
  • 11
  • 542
  • 0
Báo cáo khóa học: The role of N-linked glycosylation in the protection of human and bovine lactoferrin against tryptic proteolysis pdf

Báo cáo khóa học: The role of N-linked glycosylation in the protection of human and bovine lactoferrin against tryptic proteolysis pdf

Ngày tải lên : 30/03/2014, 13:20
... resistant to proteolytic degradation than bLF-B, the first may also be superior in protection of the mammary gland and the intestinal tract of the newborn because it is more resistant to proteolytic ... indicate the migration of the protein standards protein band of Mr 41 000 (Fig 8, lanes and 5) We speculated that this fragment of bLF-A represents the N-terminal tryptic fragment with two N-linked ... essential to protect the molecule against trypsin (Fig 4, lanes 1–3) These results contrast with the previous reported role of N-linked glycosylation in the protection of hLF against trypsin [19]...
  • 7
  • 489
  • 0
Beautiful Places: The Role of Perceived Aesthetic Beauty in Community Satisfaction docx

Beautiful Places: The Role of Perceived Aesthetic Beauty in Community Satisfaction docx

Ngày tải lên : 30/03/2014, 16:20
... satisfaction Recall that our hypothesis explicitly stated that we not think that beauty and aesthetics are the only factor that matter to community satisfaction, but rather that they are likely to ... Not at all satisfied Count % % within Count within % % within Count within % % within Count within Extremely Satisfied % % within Count within Total % % within Count within % % within within ... Director of the Prosperity Institute of Scandinavia, Jönköping International Business School (charlotta.mellander@jibs.se) Kevin Stolarick Research Director of the Martin Prosperity Institute in the...
  • 28
  • 411
  • 0
The role of PDO/PGI labelling in Italian consumers’ food choices

The role of PDO/PGI labelling in Italian consumers’ food choices

Ngày tải lên : 08/04/2014, 18:33
... denomination of origin labels The survey The survey set out to observe the factors that influence the perception and the purchasing attitude towards PDO/PGI products, to analyse the role of labelling ... sample of 400 Italian consumers to observe the factors that influence the perception and the purchasing attitude towards such products and the role of logos on the label in influencing their choices ... housewives Finally, the third cluster groups 21.4% of respondents particularly attentive to the origin of products, quality certifications and to the information contained on the label Indeed, in both...
  • 19
  • 286
  • 0
Báo cáo sinh học: " Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

Báo cáo sinh học: " Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

Ngày tải lên : 19/06/2014, 08:20
... two-way t- test Competing interests The author(s) declare that they have no competing interests Authors' contributions BMG carried out the scid vs NOD scid experiments and NK cell cytotoxicity assays ... be the relevant cellular targets whose depletion accounts for CyP's capacity to impair innate resistance to HSV-1 [56,57] Further study is needed to test this hypothesis Role of Stat in innate ... [27] Therefore, the effect of anti-asialo GM1 and anti-NK1.1 antibodies on host resistance to HSV-1 may be due, at least in part, to their capacity to blunt the T cell response to viral infections...
  • 15
  • 344
  • 0
Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt

Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt

Ngày tải lên : 20/06/2014, 01:20
... glycoprotein in respect to cleavage and transport along the exocytotic pathway To address this question, we investigated in the present report each potential N-glycosylation site of the Lassa ... N-glycan attachment Next we determined the effect of the individual N-glycans on the maturation cleavage by analysing the presence of the cleaved subunit GP-2 Disruption of the N-glycosylation sites ... contributions RE and TS carried out experiments, participated in the analysis of the results and drafted the manuscript OL helped to draft the manuscript and revised it critically WG designed the study,...
  • 7
  • 363
  • 0
báo cáo hóa học:" Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

báo cáo hóa học:" Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

Ngày tải lên : 20/06/2014, 04:20
... two-way t- test Competing interests The author(s) declare that they have no competing interests Authors' contributions BMG carried out the scid vs NOD scid experiments and NK cell cytotoxicity assays ... be the relevant cellular targets whose depletion accounts for CyP's capacity to impair innate resistance to HSV-1 [56,57] Further study is needed to test this hypothesis Role of Stat in innate ... [27] Therefore, the effect of anti-asialo GM1 and anti-NK1.1 antibodies on host resistance to HSV-1 may be due, at least in part, to their capacity to blunt the T cell response to viral infections...
  • 15
  • 296
  • 0
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

Ngày tải lên : 20/06/2014, 08:20
... product patents on medicines to comply with the World Trade Organization (WTO) Agreement on Trade Related Aspects of Intellectual Property Rights (TRIPS) The introduction of product patents in India ... suspected of infringing patents in the countries through which they transit These types of Page of border measures blocked medicines from reaching patients in Africa and Latin America in 2008 and ... content All authors read and approved the final version of the manuscript Competing interests The authors declare that they have no competing interests Received: 22 April 2010 Accepted: 14 September...
  • 9
  • 283
  • 0