the role of direct cellular communication during the development of a humoral immune response

Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc

Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc

Ngày tải lên : 11/08/2014, 08:22
... TGGCTTCCCTTTCTCAGACA GGCTACCCCCTCTCAGACAT CCAGAACAACGCAAGAAGACT TGAGAAGTTCCAATCCAGTCG TAAACGAAACAGTTCCAAGGC ATAGATGATTCAGGGATGCCC CGCAGCAAGTCTCTTATGGAA GCGACACAGCCACCTATCTC TTCATCCTAAGCACGGAGAAG TTCCCATCAGTCATCCCAAC ... ACGGTGCCCAGTCGTTTTAT ACACGGGTCACTGATACGGA AGTGTCCTTCAAACTCACCTT ATGGACAATCAGACTGCCTCA AGATAAAGGAAACCTGCCCAG GGATTCCTACCCAGCAGATTC GAAGGCTATGATGCGTCTCG AAAGGATACAGGGTCTCACGG TGGCTTCCCTTTCTCAGACA ... TTCCCATCAGTCATCCCAAC TCACTCTGAAAATCCAACCCA GCATCCTGGAAATCCTATCCT GGACAAGTTTCCAATCAGCCG AAAATGCCCTGCTAAGAAACC CAGCCTGGGAATCAGAACG BV1S 1A1 , BV2S1 BV3S 1A1 , BV4S1 BV5S1 BV2S2 BV6S 1A1 , BV7S1 BV8S1 BV8S 2A1 , 2,...
  • 10
  • 359
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Ngày tải lên : 20/02/2014, 01:20
... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C and the theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease ... average conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20...
  • 7
  • 551
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Ngày tải lên : 22/02/2014, 04:20
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...
  • 6
  • 488
  • 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Ngày tải lên : 30/03/2014, 04:20
... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... response At sites of DNA damage, the Ser129-phosphorylated H2AX derivative, cH2AX, forms foci for the recruitment of factors involved in repair of DNA damage and maintenance of the cell cycle arrest ... in the appearance of a ‘smear’ of low molecular mass DNA species that may represent some chromosome degradation (Fig 5, psy4D, h) When WT cells were washed free of the DNA-damaging agents and allowed...
  • 11
  • 362
  • 0
Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx

Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx

Ngày tải lên : 10/08/2014, 10:20
... conclusions and those of prior authors, that algometry of both symptomatic and asymptomatic body sites may have a practical clinical application in the contemporary evaluation of treatment success ... in litigation and no reasonable interpretation of the present data allows for any attribution of the observations to financial motivation or emotional liability The number of subjects in the present ... distal to the tibial tuberosity, and cm lateral to the anterior tibial margin Pain thresholds were determined by slowly and gradually increasing the pressure of the algometer tip against the marked...
  • 8
  • 531
  • 1
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Ngày tải lên : 10/08/2014, 10:20
... multivariate analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis p valueb R-status Masaoka stagingd Presence of a pseudocapsula WHOd classificatione ... Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health Organization histologic classification system reflects the oncologic behavior ... case each in patients with an incomplete encapsulated thymoma or a missing capsula Neo-Adjuvant and Adjuvant Therapy As far as a neoadjuvant or adjuvant therapy is concerned two major aspects...
  • 10
  • 355
  • 0
Báo cáo y học: " The role of the humoral immune response in the molecular evolution of the envelope C2, V3 and C3 regions in chronically HIV-2 infected patients" pdf

Báo cáo y học: " The role of the humoral immune response in the molecular evolution of the envelope C2, V3 and C3 regions in chronically HIV-2 infected patients" pdf

Ngày tải lên : 13/08/2014, 05:21
... nm against a reference wavelength of 620 nm The clinical cut-off value of the assay, calculated as the mean OD value of HIV-seronegative samples plus three times the standard deviation [SD], was ... with the interpretation of data and revision of the manuscript PB and NT preformed statistical analysis PB and NT interpreted the data and wrote the manuscript All authors reviewed and accepted the ... 2005, 310:1025-1028 Isaka Y, Sato A, Miki S, Kawauchi S, Sakaida H, Hori T, Uchiyama T, Adachi A, Hayami M, Fujiwara T, Yoshie O: Small amino acid changes in the V3 loop of human immunodeficiency...
  • 12
  • 308
  • 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Ngày tải lên : 16/10/2015, 11:57
... CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA ... potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in DNA manipulation, available ... channels and are strongly regulated by voltage They are active at the plasma membrane as inward, weakly-inward and outward channels The KCO family does not have voltage sensor domains as in Shaker family,...
  • 109
  • 382
  • 0
Báo cáo khoa học: "Efficiency of Matricaria chamomilla CH12 and number of doses of rabies vaccine on the humoral immune response in cattle" potx

Báo cáo khoa học: "Efficiency of Matricaria chamomilla CH12 and number of doses of rabies vaccine on the humoral immune response in cattle" potx

Ngày tải lên : 07/08/2014, 23:22
... From these calculations, the amount of Matricaria chamomile consumed by each cattle was determined to be about g a day We used a commercial liquid rabies vaccine (Rai-Vac; Fort Dodge Saúde Animal, ... for paired samples was used For all the analyses, the significance level was set at 5% [3] Rabies neutralizing antibody titers are typically used to evaluate the humoral immune response in cattle ... da Silva et al [11], Albas et al [1] showing that the humoral response induced by a single rabies vaccination is inefficient in protecting cattle against rabies virus because the antibodies are...
  • 3
  • 241
  • 0
Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx

Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx

Ngày tải lên : 10/08/2014, 05:22
... negative as well as the relative DNA and RNA by PCR analysis; a liver ultrasound Esposito et al AIDS Research and Therapy 2011, 8:9 http://www.aidsrestherapy.com/content/8/1/9 Page of Table Therapeutic ... EFV, efavirenz; NFV, nelfinavir; ABC, abacavir; NVP, nevirapine; LPV, lopinavir; TDF, tenofovir difumarate; fAPV, fosamprenavir; DRV, darunavir; ENF, enfuvirtide; RAL, raltegravir; ATV, atazanavir; ... before and after the beginning of an effective HAART Normalization of both indexes after the start of the new combination therapy secondary to cancers, toxic agents and drugs The three patients...
  • 5
  • 326
  • 0
Báo cáo sinh học: " Genetic vaccine for tuberculosis (pVAXhsp65) primes neonate mice for a strong immune response at the adult stage" ppt

Báo cáo sinh học: " Genetic vaccine for tuberculosis (pVAXhsp65) primes neonate mice for a strong immune response at the adult stage" ppt

Ngày tải lên : 14/08/2014, 19:22
... detected after the dose administered at the adult stage A clear effect of the age on the preferential priming for IgG 2a was observed; the earlier the vaccine was injected, the higher was the specific ... lung and heart were obtained The samples were treated with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and total RNA was isolated according to the manufacturer protocol Subsequently, RNA was ... lung, heart and kidney On days and 7, hsp65 message was still present in the muscle but did not appear in any of the other organs Hsp65 message also appeared in the liver of one animal (from...
  • 9
  • 194
  • 0
Role Of a Merchandiser in an Export House

Role Of a Merchandiser in an Export House

Ngày tải lên : 21/07/2015, 16:54
... completely and thoroughly Be aware of the characteristics of the buyer and the end consumer from the point of view of market segment, price points, age groups, fashion preferences To gauge the seasonality ... Product Development and Design capability A leading manufacturer & exporter of Knitted fabric and Knitted garments SPL designs, manufactures and sells a wide range of outer wear-T shirts, sweat shirts, ... customers in the international market The vision of the Company is to become a leading manufacturer and exporter of apparel by continuously excelling in quality, service, and customer satisfaction...
  • 20
  • 301
  • 0
EATING THE HUMBLE PIE  a NON DEFENSIVE RESPONSE TO FAILURES

EATING THE HUMBLE PIE a NON DEFENSIVE RESPONSE TO FAILURES

Ngày tải lên : 02/10/2015, 17:14
... Definition of humility was also provided, detailing humility as being aware of one’s weaknesses, modest of achievements, and acceptance of the fact that there are others who are better In contrast, participants ... contained at least 50% of the humble attributes, I conducted another onesample t-test comparing the agreed rating against 50% (i.e., at least out of of the humble attributes) and found that the ... total number of positive and negative traits listed, the proportions of positive and negative traits out of the total number of traits were computed and analyzed as dependent variables As the...
  • 70
  • 212
  • 0
EATING THE HUMBLE PIE a NON DEFENSIVE RESPONSE TO FAILURES

EATING THE HUMBLE PIE a NON DEFENSIVE RESPONSE TO FAILURES

Ngày tải lên : 05/10/2015, 19:01
... Definition of humility was also provided, detailing humility as being aware of one’s weaknesses, modest of achievements, and acceptance of the fact that there are others who are better In contrast, participants ... contained at least 50% of the humble attributes, I conducted another onesample t-test comparing the agreed rating against 50% (i.e., at least out of of the humble attributes) and found that the ... total number of positive and negative traits listed, the proportions of positive and negative traits out of the total number of traits were computed and analyzed as dependent variables As the...
  • 70
  • 267
  • 0
Báo cáo y học: "Modulation of humoral immune response to oral BCG vaccination by Mycobacterium bovis BCG Moreau Rio de Janeiro (RDJ) in healthy adults" ppsx

Báo cáo y học: "Modulation of humoral immune response to oral BCG vaccination by Mycobacterium bovis BCG Moreau Rio de Janeiro (RDJ) in healthy adults" ppsx

Ngày tải lên : 11/08/2014, 10:23
... MBOS and RTP participated in the study design and participated in the drafting of the manuscript LRCB conceived the study, data analysis, coordination, the draft and finalisation of the manuscript ... to the immune response kinetic study (Table 1) and just two of them agreed to have an oral booster vaccination 42 days after primary immunisation Of these subjects, gave a history of contact ... + Normal Normal Normal Normal Normal Normal NO YES NO NO YES YES Oral Oral Oral I.D I.D I.D infancy via the oral and intradermal routes respectively, displayed an altered humoral immune response...
  • 6
  • 302
  • 0
Báo cáo y học: "First evidence of a pro-inflammatory response to severe infection with influenza virus H1N1" pot

Báo cáo y học: "First evidence of a pro-inflammatory response to severe infection with influenza virus H1N1" pot

Ngày tải lên : 13/08/2014, 20:21
... provide an alternative version of the story: Th1 and Th17 cytokines may reflect a vigorous antiviral host response necessary for viral clearance This article [1] is the first that describes an association ... among others, to avoid triggering unwanted inflammatory phenomena, which could explain the appearance of pneumonia in these patients The results of this work also support the study of drugs that modulate ... effective therapies Similarly, the results of this study reinforce the importance of early treatment with antivirals in those patients with high risk factors, such as pregnancy, asthma, and obesity, among...
  • 2
  • 200
  • 0
THE ROLE OF MUSIC COMMUNICATION IN CINEMA potx

THE ROLE OF MUSIC COMMUNICATION IN CINEMA potx

Ngày tải lên : 07/03/2014, 14:20
... the shape of the music determines – or assists in determining – the shape of the narrative The appearance, disappearance, and reappearance of musical sound can provide or clarify the narrative ... any of the character themes serves an identical purpose to that of the leitmotif in the Wagnerian music dramas 3.2 Music can convey messages about where in the frame the audience should focus attention ... implications that underlie the drama; what Prendergast refers to as “psychological refinements” (1992, p 216) Music can convey character Rather than just associating a character with a particular...
  • 7
  • 773
  • 0
Báo cáo khoa học: The role of histones in chromatin remodelling during mammalian spermiogenesis pot

Báo cáo khoa học: The role of histones in chromatin remodelling during mammalian spermiogenesis pot

Ngày tải lên : 07/03/2014, 16:20
... comparison of H 2A/ TH 2A sequence shows three amino acid changes in a region covering the end of alpha1, loop1 and the beginning of alpha2 As a structural analysis has already shown that H 2A Loop1 is the ... remarks After analysing all the available data it clearly appears that a massive chromatin alteration occurs before histone replacement due to an extensive incorporation of histone variants as ... recombined DNA strands, and chromosomes X and Y are abnormally paired with autosomes, leading to apoptosis of mid pachytene spermatocytes [41] MacroH 2A is a long variant of H 2A, containing a large C-terminal...
  • 11
  • 616
  • 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

Ngày tải lên : 14/03/2014, 21:20
... three days later and asked if they had read the instructions (attention) If they had, they were asked a series of questions about information in the handout (recall) and also about what they had ... At the same time, patients are in a stressful environment where there is a power imbalance, educational imbalance, and where they are fearful of appearing stupid and fearful of rejection or abandonment ... in a study of 3260 enrollees in a national managed care organization in the United States, that 23% of the English-speaking and 34% of the Spanish-speaking respondents could not adequately read...
  • 18
  • 919
  • 0

Xem thêm