the nature of language as a communication tool
Tài liệu The Man of Letters as a Man of Business docx
Ngày tải lên :
17/02/2014, 19:20
... that there is always a danger
that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that
if the magazine is not to pass away with the ... thing, and not by
marketing a thing after some other man has done it or made it. The quality of the thing has nothing to do with
the economic nature of the case; the author is, in the last analysis, ... is the case of authorship as it now stands with regard to the magazines. I am not sure that the case
is in every way improved for young authors. The magazines all maintain a staff for the careful...
- 21
- 544
- 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx
Ngày tải lên :
28/06/2014, 17:21
... because they have the
affair altogether in their hands they are apt
to take advantage in it; but this does not
follow, and as a matter of fact they have
the affair no more in their own hands than
any ... it
is because I am impatient of the antiquated
and ignorant prejudice which classes the
magazines as ephemeral. They are
ephemeral in form, but in substance they
are not ephemeral, and what is best ... best in
them awaits its resurrection in the book,
which, as the first form, is so often a
lasting death. An interesting proof of the
value of the magazine to literature is the
fact that a good...
- 126
- 362
- 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx
Ngày tải lên :
28/06/2014, 17:21
... writing of
him as an Artist. Besides, as an artist he
has been done a great deal already; and a
commercial state like ours has really more
concern in him as a business man. Perhaps
it may sometime ... at
Oxford made an American collegian say
in a theme which they imagined for him in
his national parlance; and the man of
letters, as an artist, is apt to have times
and seasons when he cannot blossom.
Very ... case of authorship as it
now stands with regard to the magazines. I
IV
I doubt, indeed, whether the earnings of
literary men are absolutely as great as they
were earlier in the century, in any...
- 130
- 318
- 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot
Ngày tải lên :
18/06/2014, 19:20
... Convergent validity:
The degree of concordance between the GAD-7 scale
and the Hamilton Anxiety Scale (HAM -A) , the Hospital
Anxiety and Depression Scale (HADS, anxiety domain),
and the WHO-DAS II disability ... disability questionnaire was cal-
culated. Concordance between classifi cation criteria was
assessed by inter-rater agreement statistics (kappa) and
a Chi-square test.
All statistical calculations were ... Retest:oneweek
later, the GAD-7 scale was again administered to a
patient subsample; the retest information was used to
studythestabilityofquestionnaire measurements over
time. The latter was ensured by administering...
- 11
- 537
- 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
Ngày tải lên :
19/06/2014, 10:20
... is
to have most of the main data-set replicated across all the
sites and transmit only incremental changes. Furthermore
the main data-set is often cached locally at each of the col-
laborating ... estimated that only about 5–10% of the available fiber
has been lit, and each fiber has several terabits/s of capac-
ity. The dot-com implosion has made this dark fiber and
wavelengths of light ... various people
that are subscribers to the data. For example, a user send
their data to a multicast address and the routers that
receive the data send copies of the data to remote sites that
are...
- 10
- 449
- 0
Tài liệu Test of English as a Foreign Language doc
Ngày tải lên :
20/02/2014, 11:21
... Andorra
010 Angola
011 Anguilla
012 Antigua and Barbuda
015 Argentina
016 Armenia
017 Aruba
020 Australia
025 Austria
029 Azerbaijan
030 Azores
035 Bahamas
040 Bahrain
045 Bangladesh
050 Barbados
094 ... any depart-
ment not listed.
001 Afghanistan
003 Albania
005 Algeria
007 American Samoa
008 Andorra
010 Angola
011 Anguilla
012 Antigua and
Barbuda
015 Argentina
016 Armenia
017 Aruba ... former
Yugoslav
Republic of
350 Madagascar
353 Madeira Islands
355 Malawi
360 Malaysia
361 Maldives
363 Mali
365 Malta
367 Northern Mariana
Islands
368 Marshall Islands
366 Martinique
369 Mauritania
370 Mauritius...
- 36
- 869
- 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
Ngày tải lên :
06/03/2014, 04:20
... Mycobacteria was done
at the Corporation laboratory by primary differential
tests for atypical Mycobacteria.
Statistical analysis
As no single gold standard was available for
comparison of the performance ... 2005
Aug; 9(8): 877-83.
KAVITA MODI – PAREKH ET AL
CHANCHAL SINGH MEMORIAL AWARD - 2006
The Tuberculosis Association of India awards every year a cash
prize of Rs. 1000/- to a medical graduate ... smear
microscopy, culture and PCR. The data were
compared with available clinical information.
Radiological data was available from 61 subjects.
The study was conducted blind.
Quality of samples...
- 8
- 524
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
Ngày tải lên :
07/03/2014, 15:20
... autoradiographed. Competitor DNAs
used in EMSA analysis were: NF1 wt, 5Â-TTTTG
GATTGAAGCCAATATGATA-3Â;NF1mut,5Â-TTTT
GGATTGAATAAAATATGATA-3Â;Site-2wt,5Â-GCGT
CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT
TGTCC-3Â;Site-2mut,5Â-GCGTCTCACCCTAGTAA
TGGTAATGCTCCAAGGGTTTTTGTCC-3Â;Site-3wt,
5Â-GGGTTCTTTTGGCATCCCTGTAGC-3Â;Site-3mut,
5Â-GGGTTCTTTTTAAATCCCTGTAGC-3Â.
Chromatin ... [13].
Site-2 and Site-3 binding activity in all fractions was
monitored by the in vitro DNase I protection assay. The
DNA affinity column, used as the last step in the
purification, was prepared with an ... )525
(5Â-TGACCTTGTCTCGTTGCCTCACCC-3Â)and)378
(5Â-GCTACAGGGATGCCAAAAGAACCC-3Â)forthe
Site-3, and primer set )346 (5Â-GCGTCTCACCCTAGT
CCTGGTCCTGC-3Â)and)214 (5Â-GGAAGGGGCGGG
TCCAGAGAACA-3Â) for the Site-2 element. PCR was
performed...
- 8
- 426
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
Ngày tải lên :
18/03/2014, 01:20
... Rac2
and S10 0A9 .
Assay of NADPH oxidase activity after
oxidase activation
The dormant NADPH oxidase of neutrophil membranes
was activated by mixing neutrophil plasma membranes and
the recombinant cytosolic ... GTPcS-loaded Rac2, MgSO
4
and an optimal
amount of arachidonic acid determined for each assay of
oxidase activation [12]. The rate of O
2
–
production by the
activated NADPH oxidase was calculated ... dismutase. NADPH
oxidase activity was also assayed by polarographic meas-
urement of the rate of O
2
uptake at 20 °CwithaClark
electrode at a voltage of 0.8 V. All experiments were carried
out at...
- 10
- 396
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
Ngày tải lên :
25/03/2014, 10:41
... Albanian
AMA Amharic
ARA Arabic
ARM Armenian
ASM Assamese
AZE Azerbaijani
BAM Bambara
BAK Bashkir
BAQ Basque
BEL Belarusian
BEM Bemba
BEN Bengali
BER Berber
BIK Bikol
BOS Bosnian
BUL Bulgarian
BUR ... Kurukh
KUS Kusaiean
LAO Lao
LAV Latvian
LIN Lingala
LIT Lithuanian
LUA Luba-Lulua
LUO Luo
MAC Macedonian
MAD Madurese
MLG Malagasy
MAY Malay
MAL Malayalam
MLT Maltese
MAR Marathi
MAH Marshallese
MEN ... Ethiopia,
Gabon, Gambia, Ghana, Guinea, Guinea
Bissau, Kenya, Lesotho, Liberia, Madagascar,
Malawi, Mali, Mauritania, Mauritius,
Mozambique, Namibia, Niger, Nigeria,
Reunion, Rwanda, Sao Tome and...
- 28
- 764
- 2
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
Ngày tải lên :
30/03/2014, 04:20
... time of 4 h 38 min. In the main, the pres-
ence of a- crystallin significantly decreased formation of
this large aggregate. As a result of the interaction of
a- crystallin with reduced j-casein, a ... of nonfibrillar aggregation of j-casein, which
might have reduced the number of fibrils in favour of
amorphous aggregates. The decrease can be attributed,
at least partially, to a decrease in TFT ... the Arrhenius law,
we have: ln(k
app
) ẳ E
A
RT + ln (A) . The activation
energy of fibril formation (E
A
) was calculated
(Table 1) as the slope of the straight line fitted to a
plot of ln(k
app
)...
- 16
- 577
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
Ngày tải lên :
23/06/2014, 00:20
... information to Professor Andrzej Granas.) This result
is a discrete analog of the Banach contraction principle (BCP) and it has applications in
automata theory.
Theorem 1.1 (Eilenberg). Let X be an ... y), and therefore, each non-
Archimedean metric space has the extraordinary geometric property that each three
points of it are vertices of an isosceles triangle. We notice that non-Archimedean ... contraction theorems, [5, Example 1] concerning a comparison of two fixed
point theorems of the Meir-Keeler type). Moreover, there is also a variant of the BCP
for self-maps of a non-Archimedean...
- 6
- 268
- 0
