the isolation characterization and development of a novel class of potent antimitotic macrocyclic depsipeptides the cryptophycins

báo cáo khoa học: "Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas)" ppsx

báo cáo khoa học: "Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas)" ppsx

Ngày tải lên : 11/08/2014, 11:21
... μM of each of the four dNTPs, 0.2 μM of each of the forward and reverse primers, and one unit of Taq DNA polymerase with the following cycling profile: cycle of at 94°C, an annealing temperature ... total of 644 alleles at polymorphic loci were detected and the average number of alleles per SSR marker was 3.30 with a range of 2-10, based on the dominant scoring of the SSR bands characterized ... by Jarret and Bowen [21] and used in inheritance evaluation and mutation mechanisms of microsatellite markers [22], paternity analysis [23] and assessment of genetic diversity and relationship...
  • 9
  • 296
  • 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Ngày tải lên : 17/03/2014, 03:20
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not...
  • 8
  • 465
  • 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Ngày tải lên : 14/03/2014, 23:20
... ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC ... TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ... GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAG CGTGAATTCACCGAGCATGTCACCAAAGCC AATCAGAATGGGATCCGGTGA CGGCTGACATTCTGATTGACTTGGACGG CAATCAGAATGTCAGCCGGTGACACAGG CC AGT CAT GAT AAG CCT...
  • 14
  • 594
  • 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Ngày tải lên : 17/03/2014, 17:20
... (Tables and 2) revealed the same linkage pattern and sugar sequence as in the polysaccharide of P penneri (structure 1) and one additional sugar residue (a- GlcpII) attached at position of GalNAcI ... polysaccharide has a tetrasaccharide repeating unit containing one residue each of D-Glc and D-Gal and two D-residues of GalNAc The 1H- and 13C NMR spectra of the polysaccharide were assigned using ... resembled the spectra of the P penneri polysaccharide and belonged to a tetrasaccharide repeating unit lacking GlcII and, hence, having the structure In particular, the signal for C5 of GalNAcI in the...
  • 6
  • 560
  • 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Ngày tải lên : 23/03/2014, 09:21
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and ... Primer pairs were: #GSP-4 and #PFLF1 (lanes and 2); #GSP-2 and #GSP-4 (lanes and 4); #GSP-2 and #PFLR-1 (lanes and 6); and #PFLF-1 and #PFLR-1 (lanes and 8) (B) Schematic organization of the CrPrx...
  • 14
  • 347
  • 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

Ngày tải lên : 29/03/2014, 11:20
... synchronize the inflation and deflation of pressure suits adaptively to gain an increase in the level of gravitational accelerations that an airman is capable of tolerating Additional applications, such as ... desired passband and gain characteristics selection and preparation of electrode placement on the subject, and by keeping the bandpass characteristics of the biopotential amplifier as tight as possible ... configurable third stage further amplify the signal to an overall gain of up to million Typical applications for this biopotential amplifier are as a front-end and main amplifier for standard and topographic...
  • 478
  • 521
  • 2
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

Ngày tải lên : 10/08/2014, 05:21
... tracts were surgically excised and parts of the upper (cervicovagina), middle (midvagina), and lower (urovagina) areas of each vagina were fixed with formalin and paraffin embedded by standard ... cervicovagina, midvagina and urovagina of the rabbits in each group The final score is then expressed as mean ± standard deviation of determinations $ The mean vaginal irritation index corresponds to the ... Formulations with vaginal irritation ratings between and are considered acceptable for vaginal application [16] Statistical analysis Statistical significance of the treated group mean with that of...
  • 11
  • 480
  • 0
Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

Ngày tải lên : 14/08/2014, 08:20
... guage [48] Data were loaded into a MySQL database for subsequent querying Additional data files The following additional data are available with the online version of this paper Additional data ... the pair that has the smallest Ks among all of the gene pairs that share the same parental genes The number of retrogenes in human in this study is approximately the same as that reported by Marques ... Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis of the mouse genome Nature 2002, 420:520-562 Thomas JW, Touchman JW,...
  • 11
  • 357
  • 0
A study on electronic banking the case of Bank for Investment and Development of Vietnam

A study on electronic banking the case of Bank for Investment and Development of Vietnam

Ngày tải lên : 26/03/2015, 08:47
... possibilities offered by technology Computers and the use of one time data entry and relational databases mean that online real-time data about a company's business and accounts can be generated, enabling ... benefits and risks of e-banking? • What are the potentials and future perspectives of e-banking development in Vietnam? • What has BIDV's e-banking done so far and what are achieved results? • What are ... introduced their Internet banking one after another, such as Citibank and Bank of America Soiail and Shanmugham, 2003 1.2 FORMS OF EL EC TR O N IC BANKING Making payments for goods and serv ices in cash...
  • 121
  • 692
  • 0
A study on issuing corporate bond the case of bank for investment and development of Vietnam -BIDV

A study on issuing corporate bond the case of bank for investment and development of Vietnam -BIDV

Ngày tải lên : 26/03/2015, 08:48
... source of data has a complete advantage over all the others and given that the data sources are highly complementary and the recommendation by researchers that a good case study may want to use as ... upon the issuance, and expressed as a percentage of far The coupon payment is the amount of money calculated by multiplying coupon rate and face value and made to the bondholder The coupon rate of ... with a BBB rating and insurance companies to invest in unsecured bonds with an A or P2 rating Another key development was the incorporation of Cagamas Berhad (the Malaysian National Mortgage Corporation)...
  • 109
  • 700
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Ngày tải lên : 19/02/2014, 12:20
... Mass Methods Reference v v v m m m v v v p m m m a7 N /A a7 a3 /b4 (less active) (less active) a3 /b2, a7 a3 /b2, a7 a3 /b2, a7 a3 b2; a6 b2b3 a3 b2 /a3 b4; a7 a3 a7b4 /a3 a5b4 a3 b2 a a7 a a7 a a3b2 a3 b2 a6 b2b3 ... procedures, may reveal crucial amino acids or regions that are essential binding and structural determinants A parallel of the alanine scan approach is the synthesis of a- conotoxin variants or ÔchimerasÕ ... reduction and alkylation, their application to conopeptide analysis and characterization is by no means trivial, and often optimization on a case-by-case basis is required [14] Sample amounts may be...
  • 11
  • 554
  • 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Ngày tải lên : 20/02/2014, 03:20
... Kozianowski G, Canganella F, Rainey FA, Hippe H & Antranikian G (1997) Purication and characterization of thermostable pectate lyases from a newly isolated thermophilic bacterium Thermoanaerobacter ... v) PGA The reaction was started by the addition of an appropriate amount of PelB, and samples were taken at regular time intervals The reaction was stopped by adding 200 lL of the sample to a Somogyi ... PelB and concentrated T maritima medium fraction (supernatant) and cell extract using An exopolygalacturonase from Thermotoga maritima PGA as a substrate These revealed that PelB is located intracellularly,...
  • 10
  • 592
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA ... was performed on DNAsetreated RNA extracts Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
  • 14
  • 473
  • 0
THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx

THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx

Ngày tải lên : 08/03/2014, 23:20
... Leaf area is measured as the leaf area index (LAI), this is the ratio of the area of leaf to the land area For example, a crop with an LAI of 1.5 has 1.5 square metres of leaf for each square ... WHEAT PLANT THE WHEAT BOOK (continued) at their bases, so the oldest parts of a leaf are the tip of the blade and the top of the sheath Where the blade and sheath join, there are structures called ... season rainfall as an estimate of crop water use and a target WUE was expanded to include the water-limited yield potential of a crop and better seasonal estimates of water use and WUE 62 CHAPTER...
  • 86
  • 709
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt

Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt

Ngày tải lên : 23/03/2014, 06:20
... sulfate precipitation, and anion and gel-filtration chromatography (Fig 2A) The recombinant ClpC1 was analyzed to determine if it had an inherent ATPase activity We used radioactive ATP as the ... basal ATPase activity and has chaperone activity in preventing the aggregation of luciferase and reactivating heat-inactivated luciferase Deletion of the N-terminal conserved repeat I (amino acids ... functions The enzymatic activity of the three proteins was assayed at different pH values ClpC1 and the variants were active over a broad pH range of 6.5–12.5 The activity of all three proteins increased...
  • 10
  • 499
  • 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Ngày tải lên : 23/03/2014, 09:20
... normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area of the substrate peaks For the identification of PrtA cleavage site in the ... kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and ... between the edge of the exciting beam and the cuvette wall (1.00, 0.1 and 0.15 cm, respectively, in our measurements), and Aex and Aem are the absorbance of the sample solution at the excitation and...
  • 11
  • 424
  • 0
Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Ngày tải lên : 31/03/2014, 09:20
... CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢, and 5¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢, 3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢, respectively, ranging ... without the C-terminal arginine, was designed as follows (Fig 3A) Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢, 3¢-CTCCAGCTGTACGCGACGTTCAGCAG ... that separates the Ca of the lysine from the centre of ˚ the benzene ring of the tyrosine is 6.805 ± 0.406 A We can imagine that the toxin interacts with the channel like a moon lander system and...
  • 12
  • 502
  • 0
Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf

Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf

Ngày tải lên : 19/06/2014, 08:20
... therapies cannot be passive and patients must be engaged Perhaps part of the 'magic' in the hands of the individual therapist might be the ability to engage the patient and direct appropriate attention ... clinical presentation and recovery prognosis Thickbroom and Mastaglia outline important considerations for advancing NBS as a potential therapeutic tool in disorders of the brain and spinal cord ... stimulation paradigm The authors suggest that the combination of NBS with functional therapies has the potential to drive plastic changes in brain-damaged patients, only if guided by a careful...
  • 4
  • 452
  • 0
Báo cáo toán học: " IPv6 address autoconfiguration in geonetworking-enabled VANETs: characterization and evaluation of the ETSI solution" ppt

Báo cáo toán học: " IPv6 address autoconfiguration in geonetworking-enabled VANETs: characterization and evaluation of the ETSI solution" ppt

Ngày tải lên : 20/06/2014, 20:20
... network are feasible There are three is the number of available lanes in a road Our pre- parameters that have an impact on the probability of vious analysis is valid regardless of the number of having ... ETSI standardized mechanism In the rest of the paper we refer to the ETSI IPv6 address stateless autoconfiguration solution as ETSI SLAAC ETSI SLAAC adapts the standard IPv6 SLAAC (Stateless Address ... from real traffic traces, and measure the ETSI SLAAC configuration time The traces were taken at the 4-lane In this section we take a step further and experimentally evaluate the performance of the...
  • 33
  • 381
  • 0
Organization and Development of Russian Business A Firm-Level Analysis_1 potx

Organization and Development of Russian Business A Firm-Level Analysis_1 potx

Ngày tải lên : 20/06/2014, 23:20
... difference was a much larger amount of accumulated wealth under the command of the state and the availability of rich natural resources On the one hand, this enabled the state to postpone the necessary ... significantly increases the chances to obtain financial and organizational support from the state and, thus, is a rational strategy of market players In Chapter 12, we analyze the influence of the ... consisted of the liberalization of prices and foreign trade, privatization, the establishment of a tax system, the introduction of antimonopoly legislation, and the creation of a system of financial...
  • 23
  • 335
  • 0

Xem thêm