... μM of each ofthe four dNTPs, 0.2 μM of each ofthe forward and reverse primers, and one unit of Taq DNA polymerase with the following cycling profile: cycle of at 94°C, an annealing temperature ... total of 644 alleles at polymorphic loci were detected andthe average number of alleles per SSR marker was 3.30 with a range of 2-10, based on the dominant scoring ofthe SSR bands characterized ... by Jarret and Bowen [21] and used in inheritance evaluation and mutation mechanisms of microsatellite markers [22], paternity analysis [23] and assessment of genetic diversity and relationship...
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolationand ... 5¢-RACE andthe two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not...
... (Tables and 2) revealed the same linkage pattern and sugar sequence as in the polysaccharide of P penneri (structure 1) and one additional sugar residue (a- GlcpII) attached at position of GalNAcI ... polysaccharide has a tetrasaccharide repeating unit containing one residue each of D-Glc and D-Gal and two D-residues of GalNAc The 1H- and 13C NMR spectra ofthe polysaccharide were assigned using ... resembled the spectra ofthe P penneri polysaccharide and belonged to a tetrasaccharide repeating unit lacking GlcII and, hence, having the structure In particular, the signal for C5 of GalNAcI in the...
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and ... Primer pairs were: #GSP-4 and #PFLF1 (lanes and 2); #GSP-2 and #GSP-4 (lanes and 4); #GSP-2 and #PFLR-1 (lanes and 6); and #PFLF-1 and #PFLR-1 (lanes and 8) (B) Schematic organization ofthe CrPrx...
... synchronize the inflation and deflation of pressure suits adaptively to gain an increase in the level of gravitational accelerations that an airman is capable of tolerating Additional applications, such as ... desired passband and gain characteristics selection and preparation of electrode placement on the subject, and by keeping the bandpass characteristics ofthe biopotential amplifier as tight as possible ... configurable third stage further amplify the signal to an overall gain of up to million Typical applications for this biopotential amplifier are as a front-end and main amplifier for standard and topographic...
... tracts were surgically excised and parts ofthe upper (cervicovagina), middle (midvagina), and lower (urovagina) areas of each vagina were fixed with formalin and paraffin embedded by standard ... cervicovagina, midvagina and urovagina ofthe rabbits in each group The final score is then expressed as mean ± standard deviation of determinations $ The mean vaginal irritation index corresponds to the ... Formulations with vaginal irritation ratings between and are considered acceptable for vaginal application [16] Statistical analysis Statistical significance ofthe treated group mean with that of...
... guage [48] Data were loaded into a MySQL database for subsequent querying Additional data files The following additional data are available with the online version of this paper Additional data ... the pair that has the smallest Ks among all ofthe gene pairs that share the same parental genes The number of retrogenes in human in this study is approximately the same as that reported by Marques ... Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis ofthe mouse genome Nature 2002, 420:520-562 Thomas JW, Touchman JW,...
... possibilities offered by technology Computers andthe use of one time data entry and relational databases mean that online real-time data about a company's business and accounts can be generated, enabling ... benefits and risks of e-banking? • What are the potentials and future perspectives of e-banking development in Vietnam? • What has BIDV's e-banking done so far and what are achieved results? • What are ... introduced their Internet banking one after another, such as Citibank and Bank of America Soiail and Shanmugham, 2003 1.2 FORMS OF EL EC TR O N IC BANKING Making payments for goods and serv ices in cash...
... source of data has a complete advantage over all the others and given that the data sources are highly complementary andthe recommendation by researchers that a good case study may want to use as ... upon the issuance, and expressed as a percentage of far The coupon payment is the amount of money calculated by multiplying coupon rate and face value and made to the bondholder The coupon rate of ... with a BBB rating and insurance companies to invest in unsecured bonds with an A or P2 rating Another key development was the incorporation of Cagamas Berhad (the Malaysian National Mortgage Corporation)...
... Mass Methods Reference v v v m m m v v v p m m m a7 N /A a7 a3 /b4 (less active) (less active) a3 /b2, a7 a3 /b2, a7 a3 /b2, a7 a3 b2; a6 b2b3 a3 b2 /a3 b4; a7 a3 a7b4 /a3 a5b4 a3 b2 a a7 a a7 a a3b2 a3 b2 a6 b2b3 ... procedures, may reveal crucial amino acids or regions that are essential binding and structural determinants A parallel ofthe alanine scan approach is the synthesis of a- conotoxin variants or ÔchimerasÕ ... reduction and alkylation, their application to conopeptide analysis andcharacterization is by no means trivial, and often optimization on a case-by-case basis is required [14] Sample amounts may be...
... Kozianowski G, Canganella F, Rainey FA, Hippe H & Antranikian G (1997) Purication andcharacterizationof thermostable pectate lyases from a newly isolated thermophilic bacterium Thermoanaerobacter ... v) PGA The reaction was started by the addition of an appropriate amount of PelB, and samples were taken at regular time intervals The reaction was stopped by adding 200 lL ofthe sample to a Somogyi ... PelB and concentrated T maritima medium fraction (supernatant) and cell extract using An exopolygalacturonase from Thermotoga maritima PGA as a substrate These revealed that PelB is located intracellularly,...
... CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA ... was performed on DNAsetreated RNA extracts Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
... Leaf area is measured as the leaf area index (LAI), this is the ratio ofthe area of leaf to the land area For example, a crop with an LAI of 1.5 has 1.5 square metres of leaf for each square ... WHEAT PLANT THE WHEAT BOOK (continued) at their bases, so the oldest parts ofa leaf are the tip ofthe blade andthe top ofthe sheath Where the blade and sheath join, there are structures called ... season rainfall as an estimate of crop water use anda target WUE was expanded to include the water-limited yield potential ofa crop and better seasonal estimates of water use and WUE 62 CHAPTER...
... sulfate precipitation, and anion and gel-filtration chromatography (Fig 2A) The recombinant ClpC1 was analyzed to determine if it had an inherent ATPase activity We used radioactive ATP as the ... basal ATPase activity and has chaperone activity in preventing the aggregation of luciferase and reactivating heat-inactivated luciferase Deletion ofthe N-terminal conserved repeat I (amino acids ... functions The enzymatic activity ofthe three proteins was assayed at different pH values ClpC1 andthe variants were active over a broad pH range of 6.5–12.5 The activity of all three proteins increased...
... normalized with the internal standard, andthe degree of cleavage was calculated from the reduction in the normalized area ofthe substrate peaks For the identification of PrtA cleavage site in the ... kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and ... between the edge ofthe exciting beam andthe cuvette wall (1.00, 0.1 and 0.15 cm, respectively, in our measurements), and Aex and Aem are the absorbance ofthe sample solution at the excitation and...
... CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢, and 5¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢, 3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢, respectively, ranging ... without the C-terminal arginine, was designed as follows (Fig 3A) Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢, 3¢-CTCCAGCTGTACGCGACGTTCAGCAG ... that separates the Ca ofthe lysine from the centre of ˚ the benzene ring ofthe tyrosine is 6.805 ± 0.406 A We can imagine that the toxin interacts with the channel like a moon lander system and...
... therapies cannot be passive and patients must be engaged Perhaps part ofthe 'magic' in the hands ofthe individual therapist might be the ability to engage the patient and direct appropriate attention ... clinical presentation and recovery prognosis Thickbroom and Mastaglia outline important considerations for advancing NBS as a potential therapeutic tool in disorders ofthe brain and spinal cord ... stimulation paradigm The authors suggest that the combination of NBS with functional therapies has the potential to drive plastic changes in brain-damaged patients, only if guided by a careful...
... network are feasible There are three is the number of available lanes in a road Our pre- parameters that have an impact on the probability of vious analysis is valid regardless ofthe number of having ... ETSI standardized mechanism In the rest ofthe paper we refer to the ETSI IPv6 address stateless autoconfiguration solution as ETSI SLAAC ETSI SLAAC adapts the standard IPv6 SLAAC (Stateless Address ... from real traffic traces, and measure the ETSI SLAAC configuration time The traces were taken at the 4-lane In this section we take a step further and experimentally evaluate the performance of the...
... difference was a much larger amount of accumulated wealth under the command ofthe state andthe availability of rich natural resources On the one hand, this enabled the state to postpone the necessary ... significantly increases the chances to obtain financial and organizational support from the state and, thus, is a rational strategy of market players In Chapter 12, we analyze the influence ofthe ... consisted ofthe liberalization of prices and foreign trade, privatization, the establishment ofa tax system, the introduction of antimonopoly legislation, andthe creation ofa system of financial...