the case of a semi rural community in south africa
Tài liệu Multiple Vulnerabilities qualitave data for the stydy of orpharns and vulnerable children in South Africa ppt
... gave us a tour of Thabong and other areas surrounding the township, Elizabeth Noe, Gladys Khasu and Rosina Thajana, and last, but not least, Rev Paul Okpon • In Kanana: Ms Nella Modjanaga and Mr ... taking in children for the purposes to take advantage of their grants A number were accused of taking the grants for themselves and providing minimal care and assistance to the children that they ... on farms and in rural areas, which are often also more invisible There are varying constructions of poverty, but using a straight World Bank approach of a dollar a day’ (World Bank, 2000), indications...
- 118
- 628
- 0
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx
... occupational therapy assessments and coordination of medication issuing One major disadvantage of the teams’ location was the historical, custodial reputation of state institutions The team therefore ... Saude Publica 2000, 34:280-285 12 Lazarus R: Managing de-institutionalization in a context of change: The case of Gauteng, South Africa S Afr Psychiatry Rev 2005;8:65-69 South African Psychiatry ... route, as one of the advantages of the service is the streamlined access to beds when in crisis One may speculate that these outcomes reflect more on the level of standard care in South Africa rather...
- 8
- 310
- 0
Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx
... publish their work in journals indexed by Index Medicus and the Institute for Scientific Information because of the visibility of papers appearing in the PubMed database and the influence of their ... collected the data MEF drafted the manuscript All authors contributed in the writing and preparation of the manuscript All authors read and approved the final manuscript References Dinkel A, Berth ... about the future of languages in science Competing interests There is a growing debate around the world about the rapid penetration of the English language into various expressions of human activity,...
- 2
- 481
- 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade that can listed here as CISG ... line with the registration - Registering, enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws - Ensuring product quality in ... risks in case of a court that merely bases on non-verbal transaction For example, in the event, the Company wants to change quantity of a certain kind of ordered goods, in stead of a written amendment,...
- 41
- 614
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... Molecular characterization of a 500 kDa bc1 sub-complex in the yeast deletion strains lacking Qcr9p, ISP or Bcs1p BN ⁄ PAGE analysis of a yeast mutant strain in which the gene encoding the Qcr9p ... however, the interaction between the bc1 subunits was hypothesized only indirectly by assaying the steady-state levels of the remaining subunits in the mitochondrial membranes of yeast strains in which...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the ... was prepared by incubating catechol with resting cells of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino-3hydroxybenzoic ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... formed The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... L-methionine the rate of abstraction of the a- proton, leading to formation of the quinonoid intermediate, is less by a factor of 2.5 than for the reaction with L-phenylalanine The observed retardation ... comparison of the rates of formal ÔreprotonationÕ (kr) for the normal and a- deuterated substrates in D2O allowed us to establish if there was any internal return of the a- proton after its abstraction...
- 7
- 532
- 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... least because it was instrumental in creating an independent Catholic state out of the world’s largest Islamic polity; and the post-9/11 war against al Qaeda.3 At the same time, globalization and ... furthering the interests of another country at the expense of Australia’s interests.9 The end of the Cold War, the rise of al Qaeda, preparations for the 2000 Olympic Games in Sydney, the 9/11 attacks,...
- 218
- 375
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...
- 11
- 584
- 0
Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx
... conveyed by any price level movement is information concerning the central bank's failure to maintain a stable value of nominal spending An analogy may help clarify the example Imagine that you are listening ... superfluous at best: even if they not alter a single note, they are certainly distracting, and they certainly are not an accurate and transparent reflection of what Bach intended The only valuable information ... money, leading to a change in the overall demand for final goods and seIVices, that is, in aggregate spending or 'nominal income' A central bank might, in principle at least, manage the stock of money...
- 83
- 323
- 0
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx
... a cylinder, use the formula V = r2h h r S URFACE A REA The surface area of an object measures the combined area of each of its faces The total surface area of a rectangular solid is double the ... (the median), and/or the average of all the values (the mean) M EAN AND M EDIAN To find the average, or the mean, of a set of numbers, add all the numbers together and divide by the quantity of ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and...
- 25
- 410
- 0
Báo cáo hóa học: " A case study of GM maize gene flow in South Africa" potx
... study and participated in its design and implementation, final data analysis and draft and final manuscript preparation LC participated in the design of the study, data collection and analysis, ... other maize within a 3-km radius to other maize plantings in the area Weather data (wind speed, wind direction, temperature and relative humidity) were captured (5 days during flowering) using a mobile ... logarithmically and subjected to a linear trend line The mean crosspollination over distance per location per year was Page of compared to the combined means over all data sets The logarithmic high values...
- 8
- 452
- 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx
... between Fl and P2) are also heterogeneous AA or AB animals (BC1) and AB or BB animals (BC2) with proportions 1/2, 1/2 The statistical analysis of the data obtained from these populations was clearly ... In the Cl cases, the backcrosses were not produced and the segregation of the major gene was visible only in the F2 In the C2 cases, the F2 was absent and the backcrosses were present in equal ... emphasized These curves are nearly linear for power under 70% and, in this linear part, the slope (ie the gain in power = = = per extra individual measured) increases with a The resulting increase...
- 11
- 368
- 0
Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx
... tissues, and explained the finding as the expression of an abnormal processing of nociceptive information in the brain and spinal cord [2-7] Others have postulated that chronicposttraumatic myalgia ... Discussion The present data demonstrate a remarkably rapid change in central sensitization symptoms following the anesthetizing of painful trigger points Since the infraspinatus PPT site was relatively ... study the authors set out to evaluate whether anesthetic infiltration of myofascial trigger points in patients with chronic and refractory neck pain can affect pain thresholds in uninjured parts of...
- 8
- 531
- 1
báo cáo khoa học: " Traditional agroecosystems as conservatories and incubators of cultivated plant varietal diversity: the case of fig (Ficus carica L.) in Morocco" ppsx
... responding to such new challenges Methods Fig sampling Traditional agroecosystems are still present in Morocco, in the Rif and Atlas mountains in Northern and central areas and in oases in the South ... HA, MA, AO and BK performed fig sampling HA, SS and BK carried out the molecular analysis HA, FK and BK performed the statistical analysis and wrote the first draft of the manuscript All authors ... always the case in clonally propagated plants For instance, while sexual reproduction seems to be most important in traditional Cassava cultivation, genetics allow to trace its origin to a single...
- 12
- 344
- 0
Study on corporate governance index of Vietnam commercial bank – the case of a newly established, medium to large joint stock commercial ban
... (ROA) ranked among top 20 banks Secondary information and data of the bank includes the bank annual report, audited financial reports, reports and other materials in general shareholders’ meeting ... there is a cross lending in the bank which investors cannot find this information easily One of the main shareholders of the bank has borrowed from the bank a loan which has value far exceeding ... Vietnam Banks and international standards in that the scores are substantially below the maximum level However, in scoring the index, some indicators need to be modified and an indepth qualitative...
- 8
- 432
- 1
Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg
... Academy of Sciences of the United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, ... of Mathematical Analysis and Applications, vol 158, no 1, pp 106–113, 1991 20 Th M Rassias, “On the stability of functional equations in Banach spaces,” Journal of Mathematical Analysis and Applications, ... Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society, vol 72, no 2, pp 297–300, 1978 D G Bourgin, “Classes of transformations and...
- 10
- 296
- 0
Impact of Working Capital Management on Firms’ Performance: The Case of Selected Metal Manufacturing Companies in Addis Ababa, Ethiopia
... remains the same As the sales increase working capital increase in a slower rate As the sales increase the level of working capital rises in misappropriate manner i.e the working capital ... develop an understanding of the advantages and disadvantages of financial practices and techniques of managing Working Capital Components in metal company’s paradigms The study would reveal how ... Impact of Working Capital Management on Firms’ Performance: The Case of Selected Metal Manufacturing Companies in Addis Ababa, Ethiopia A Thesis Submitted to the Department of Accounting and Finance...
- 97
- 826
- 0
The impact of and responses to HIV/AIDS in the private security and legal services industry in South Africa potx
... in 34 workplaces involved mainly in mining and manufacturing in Botswana, South Africa and Zambia during 2000–2001, found a national prevalence rate of 14.5% in South Africa and showed that the ... rites of passage, marriage and death In addition to the above, other social and economic factors that are crucial in driving the HIV/AIDS epidemic in South Africa are stigma and denial associated ... Africa During the past decade, several studies have been published that have examined the impact of HIV/AIDS on various sectors of the economy in South Africa, including mining and manufacturing...
- 192
- 478
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25