the c language is derived from which of the following predecessor
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
Ngày tải lên :
07/03/2014, 10:20
... R1NSph (5Â-CAGCGC
ATGCTGCTCCAGGCAGCCGAC-3Â), and one of the
reverse primers R1D65Pst (5Â-CGAGCTGCAG
GGCCAT
CAGGACGACGTC-3Â) or R1D60Pst (5Â-CGAGCTGCAG
GTCCATCAGGACGAC
GGCCGGGGCGGTCTTGC-3Â).
The PstI ... 5Â-CCCATATGACCCCCACCCCGCAGCCG
CC-3Â, consisting of an NdeI restriction site (in bold type),
followed by the sequence encoding the N-terminal amino
acids of SenR, and SenR2, 5Â-CGCGCTCGAGAGACAGG
AGGCGTTGTTC-3Â, ... and characteristics, see above
II ⁄ IIIEcorev GGGAATTCGGGCCGAGGATCGGTTCCGGGAGCGACCGACGCCCCCTCCTCAGCATGTCC
(located upstream of hbpS and ending at the 5Â -end of binding site III, and containing...
- 14
- 428
- 0
The Education Of The Negro Prior To 1861 - A History of the Education of the Colored People of the United States from the Beginning of Slavery to the Civil War pdf
Ngày tải lên :
31/03/2014, 18:20
... due to the high character of the colonists, to the mutual aid resulting from the proximity of
the communities, and to the coöperation of the Canadians. The previous experience of most of these
adventurers ... to be incompetency and liability to abuse their office and
influence to the injury of the laws and peace of the country. The elimination of the Christian teachers of the
Negro race, and the prevention ... maintain schools despite the fact that the fear of servile insurrection
caused the State to exercise due vigilance in the execution of the laws. The father of Richard De Baptiste of
Fredericksburg...
- 191
- 503
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
Ngày tải lên :
19/02/2014, 12:20
... nonspeci c hydrolysis, of the polypeptide chain.
When investigating the effect of pH on the cyclization
reaction, we expected that an acidic pH might enhance
the rate of conversion of (Gln1)-ONC(M23L) ... that the procedure
described in this work for the activation of ONC has no
detrimental effect on the conformational stability of the
enzyme.
Cytotoxic activity
The effect of (Met1) removal on the ... by
MALDI-TOF MS. The measured molecular mass of the
purified product was 11 799.70 ± 2, which concurs closely
with activated (Pyr)-ONC (M23L), which has a theoretical
molecular mass of 11 801.60.
Contribution...
- 9
- 704
- 0
Structure of the S15,S6,S18-rRNA Complex:Assembly of the 30S Ribosome Central Domain
Ngày tải lên :
13/03/2014, 19:08
... where ͉f
calc
͉ is the calculated heavy-atom structure factor amplitude for centric reections. The phasing power is the ratio of
the mean calculated heavy-atom structure factor amplitude to the mean ... birefringence
studies, and the conformation of the bound
junction is clearly seen in the structure of the
Tth T4 RNP (Fig. 2C) and in the structure of the
30S subunit (1).
Biochemical studies of the ... packs
tightly with the other helices, similar to the
nuclear magnetic resonance structure of the free
protein (19) but unlike the crystal structure of
the free protein (20), in which ␣1 lies distal...
- 6
- 363
- 0
Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
Ngày tải lên :
16/03/2014, 11:20
... cruzipain
Complementary oligonucleotides directed to residues
Cys19 (5Â-GCGGATCCTGCCTCGTCCCCGCGGCG-3Â)
and Gly122 (5Â-CGCCCGGGGCCAACAACCTCCACG-
TC-3Â), which span the full-length predicted prodomain of
the ... prostate cancer cells derived from
brain metastasis of human prostate cancer were obtained
from the ATCC, and human primary cultures of smooth
muscle cells (Cell Bank of Rio de Janeiro) were cultivated ... His-tag); (b) the six
histidines of the tag; (c) the full-length propeptide of cru-
zipain (Cys19–Gly122); and (d) residues RGVDLQPS-
LIS at the C- terminus, which resulted from the fusion of
the...
- 11
- 385
- 0
Báo cáo khoa học: Determination of the redox potentials and electron transfer properties of the FAD- and FMN-binding domains of the human oxidoreductase NR1 doc
Ngày tải lên :
23/03/2014, 21:20
... 5Â-TGGAATCCATATGCCGAG
CCCGCAGCTTCTG-3Â and 5Â-GGAATTCCGGATCC
TTAGGGCAGGGGGACTCC-3Â as forward and reverse
primers, respectively. Following amplification, the PCR
product was cloned into pCR Blunt (Invitrogen) ... concentration of the FMN domain is increased indicates
that the reaction rate is controlled by some process other
than collision of the two flavin-binding domains.
Discussion
The ability to dissect ... this domain. The presence of the His-
tag on the FAD/NADPH domain had no apparent effect
on catalytic activity.
The purified domains were yellow, indicating the presence
of bound cofactor, and they...
- 12
- 439
- 0
Báo cáo khoa học: Expression, purification and characterization of the second Kunitz-type protease inhibitor domain of the human WFIKKN protein pot
Ngày tải lên :
31/03/2014, 01:20
... with the 5Â-GAG TCG ACC GAC GCC TGC
GTG CTG CCT GC-3Â sense, and 5Â-GCA AGC TTA
CGG CAC GGG GCA GGC ATC CTC-3Â antisense
primers from a plasmid containing the cDNA coding for
WFIKKN protein. The ... Results and discussion
Structural characterization of the recombinant
Kunitz-module of human WFIKKN protein
The circular dichroism spectra of the second Kunitz-module
of WFIKKN protein (hereafter ... inhibitor module of human WFIKKN. The solid line indicates
the spectrum of the recombinant protein, the dotted line indicates the
CDPro-predicted spectrum of a protein consisting of 0.051 regular
b-strand,...
- 7
- 292
- 0
Báo cáo hóa học: " Comparison of the self-administered and interviewer-administered modes of the child-OIDP" ppt
Ngày tải lên :
18/06/2014, 22:20
... analysis and participated in writing the manuscript,
KOB participated in the study design and critically
reviewed the manuscript, AS conceived of the study and
critically reviewed the manuscript, CO ... were all further categorised into
3-point scales for the analysis.
Data analysis
The analysis started with a baseline comparison of socio-
demographic characteristics and self-perceived measures
between ... effective
than the current face-to-face interview and would further
facilitate the applicability of the instrument in both clini-
cal practice and population epidemiological survey set-
tings. Therefore,...
- 8
- 515
- 0
báo cáo hóa học:" Revision hip replacement for recurrent Hydatid disease of the pelvis: a case report and review of the literature" doc
Ngày tải lên :
20/06/2014, 04:20
... the musculoskeletal system [1-11]. Involvement
of the musculoskeletal system occurs in 1% to 4% of all
cases [7]. Hydatid disease is a parasitic infection caused
by tapeworm Echinococcus whic h ... visible cysts. The acetabular component was loose
and it was easily removed. There was a complete loss of
posterior column with discontinuity of ilium from pelvis.
Curettage and excision of all the ... Grimer
Abstract
A case of a large recurrent hydatid cyst involving the right ilium and right hip treated with excision of the cyst,
Total hip replacement and revision of the acetabular component with...
- 5
- 476
- 0
báo cáo hóa học:" Repositioning and stabilization of the radial styloid process in comminuted fractures of the distal radius using a single approach: the radio-volar double plating technique" pot
Ngày tải lên :
20/06/2014, 04:20
... Kohut
Abstract
Background: A possible difficulty in intra-articular fracture of the distal radius is the displacement tendency of the
radial styloid process due to the tension of the brachioradialis tendon.
Methods: ... surface during reduc-
tion is necessa ry, a single vo lar approach is contraindi-
cated unless sufficient control of the articular surface
can be provided by arthroscopy [24]. This can be the
case ... radiographic evidence of fracture
healing.
Figure 1 Rad ial styloid dislocation and reduction. Dislocation of
the radial styloid process is favored by the traction of the
brachioradialis tendon. The...
- 6
- 503
- 0
Báo cáo lâm nghiệp: "Verification of the food supply to game under conditions of the floodplain forest ecosystem" docx
Ngày tải lên :
07/08/2014, 10:21
... capacity,
0.81% is of considerable carrying capacity, and 0.83%
is of low carrying capacity.
Numerical stock of game
At the end of the last century, there were high
stocks of game in the Soutok Game ...
the carrying capacity of edaphic categories, so called
potential carrying capacity (Table 2).
Based on the calculation documented in Table 2,
the maximum number of converted units of hoofed ... MJ. To assess the sufficient
food amount from the aspect of quality, the need for
energy was calculated on the basis of the metabolic
Table 2. Calculation of conversion units of hoofed game on...
- 8
- 346
- 0
báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc
Ngày tải lên :
09/08/2014, 01:24
... 2).
Numerous sections from theuterusandtheadnexae
showed no evidence of tumor.
Immunohistochemistry
Immunohistochemical staining for cytokeratin 7 deco-
rated cells of the epithelial component and scattered
cells ... and the immunohistochemical analysis of our case, we believe that this is a monoclonal tumor
with carcinoma being the “precursor” element. Nevertheless, further molecular and genetic evidence is ... Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution,...
- 4
- 461
- 0
báo cáo khoa học: "Giant Merkel cell carcinoma of the eyelid: a case report and review of the literature" potx
Ngày tải lên :
09/08/2014, 01:24
... exact diagnosis of MCC
is made with a biopsy, for special stains are used to dis-
tinguish. Immunohistochemistry is very helpful. MCC
from other forms of cancer, such as sebaceous cyst,
small cell ... paranuclear or crescentic pattern.
Syn Neurofilament is also expressed in the cytoplasm of
most MCC. The above findings support the diagnosis of
primary MCC.
Diagnosis of MCC involves the following: ... further case of the unusual tumor in the eyelid with
histological, pictorial and immunohistochemic al studies,
which supports the hypothesis that it is derived from
Merkel cells. We consider the...
- 5
- 434
- 0
báo cáo khoa học: "A male case of an undifferentiated carcinoma with osteoclast-like giant cells originating in an indeterminate mucin-producing cystic neoplasm of the pancreas. A case report and review of the literature" docx
Ngày tải lên :
09/08/2014, 02:21
... the pancreatic tail. The patient
underwent distal pancreatectomy/splenectomy/total gastrectomy/cholecystectomy. The mass consisted of a
multilocular cystic lesion. Microscopically, the cyst was ... of circulating precursor cells
to OGCs.
Table 1 Clinicopathological findings of UC with OGCs of the pancreas originating in mucinous cystic neoplasms (MCN)
and indeterminate mucin-producing cystic ... in the bottom of the solid part of this cystic tumor. (C) Near the carcinoma in situ, OGCs were distributed diffusely in
the stroma of the cyst wall. (D) The tumor showed the invasion to the...
- 6
- 394
- 0
