the anatomy of a c program
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
... several other academic search engines, many of which are now public companies Compared to the growth of the Web and the importance of search engines there are precious few documents about recent ... (only values are actually used because 111 is the flag that signals a fancy hit) A fancy hit consists of a capitalization bit, the font size set to to indicate it is a fancy hit, bits to encode the ... into docIDs It puts the anchor text into the forward index, associated with the docID that the anchor points to It also generates a database of links which are pairs of docIDs The links database...
- 20
- 571
- 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx
... psychological and pharmacological treatment, and to determine facilitators and obstacles Secondary outcomes (percentage accuracy of depressiondetection in usual care, prevalence of depression-diagnosis ... offered a personal day structure program made by the nursing staff in collaboration with the recreational therapist Exercise and music therapy can be part of this day program Psycho-education is also ... program Act In case of Depression (AID), a multidisciplinary care program to identify and treat depression and monitor treatment effects The care program is based on and in accordance with the recommendations...
- 7
- 484
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... consumption calculated by two-tailed Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis ... hospital after introducing an antibiotic policy Eur J Clin Pharmacol 2000; 56:97-101 Saizy-Callaert S, Causse R, Furhman C, Le Paih MF, Thộbault A, Chouaùd C Impact of a multidisciplinary approach ... Inspite of increased consumption of piperacillin-tazobactam after the NARP, the resistance rates of E.coli and Klebsiella spp against piperacillin-tazobactam did not increase significantly (rho:0.626,...
- 6
- 692
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Perak, Selangor and Malacca Penang has a large electronic industry and producing computer chips and semiconductors generates a lot of wastewater, toxic chemicals and hazardous gases In Malacca, ... culture in Malacca, cockles at Kuala Juru and prawn farms at Kuala Muda have incurred heavy financial losses 29 UNEP/SCS – National Report Malaysia In the urban centres, there has been a steady...
- 88
- 581
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... of Bradford [50], using BSA as standard Ascorbic acid determination Mycobacterial cells were extracted with 5% m-phosphoric acid [51] or 5% perchloric acid [52], as described Ascorbic acid was...
- 11
- 571
- 0
Research " CULTURE AND THE EFECTIVENESS OF SUPPLIER DIVERSITY PROGRAMS: A TEST OF PREDICTORS " doc
... effective negotiations and contracting, practices which have evolved dramatically over the last 90 years It is difficult to establish, with complete accuracy the first occurrence of commercial ... management scholars began adopting the concept of culture Schein was influential because he, more so than others, articulated a conceptual framework for analyzing the culture of organizations (Hatch 1993) ... Cronbach’s Alpha A factor analysis was performed to determine the correlations and factor loadings of the constructs Data Collection A survey questionnaire was selected because of the structure...
- 84
- 344
- 0
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
... thousand babies, and the average age among adults living in the area (as a proxy for the demand for health care).16 The first column of Table shows the mean across all areas and years and the standard ... takeup rate in each area-year cell under the two counter- factual scenarios, and then compute the mean of the predictions for each year by taking the weighted average across HAs The predictions are ... Institute of Medicine of the National Academies (2001, 2004), the American Academy of Pediatrics (Halsey et al 2001), the UK Medical Research Council (2001), and by Demicheli et al (2005) for the Cochrane...
- 58
- 521
- 0
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx
... undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore largely ... to evaluate HIV/AIDS expenditure allocation – in terms of economic classification (capital and recurrent) or functional classification (prevention, care and support, and treatment) The allocation ... HIV/AIDS allocation as part of the budgetary allocations to the Department of Health and other sectoral departments • the HIV/AIDS allocation as part of the Equitable Share grant to provincial governments...
- 63
- 312
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
- 11
- 679
- 0
The Anatomy of Clickbot.A pdf
... a syndicator, and serves as a location from which a bot client can access URLs to click on In another flavor of attack, the bot operator may Doorway Site Redirector Clickbot .A Syndicated Search ... clicks on an ad on sub-syn-search.com, then fict-search.com pays syn-search.com a share of the CPC it receives from the advertiser, and, in turn, syn-search.com pays a share of the revenue it receives ... Estimated Dollar Fraud = Total bot clicks * P(click may lead to an ad) * P(click on an ad) * Average Cost Per Click The total bot clicks is the number of IP addresses contained in the botmaster database...
- 11
- 575
- 0
the broadband problem anatomy of a market failure and a policy dilemma
... policy, and conflict of interest regulations for government service and academic research Since a considerable part of this book concerns various financial conflicts of interest and their impact ... competitive local exchange carriers (CLECs) were created Some—such as Covad, Northpoint, RCN, McCleod, Williams, and many others—raised large amounts of capital regardless of the sustainability ... technologies, companies, and industries tend to have a characteristic life cycle Early in the cycle, many new entrants appear, all racing to commercialize a new technology By the time the technology achieves...
- 253
- 405
- 0
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... 93(2):221-5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement ... improving the physical fitness of a sedentary group of adults, but was also successful at increasing physical activity levels peak However although cardiovascular fitness and physical activity are ... [13], and a reduced accumulation of collagen in the arterial wall [14] Therefore guidelines recommend that individuals accrue 30 minutes of moderate physical activity on at least days of the week...
- 10
- 662
- 0
báo cáo khoa học: " Individual and setting level predictors of the implementation of a skin cancer prevention program: a multilevel analysis" docx
... level variables As a first step, a null model was fit to calculate intraclass correlation coefficients (ICCs) The ICC is an indicator of the degree of clustering and is calculated as the proportion ... based on the change in deviance or comparison of AIC values) were retained in the analysis regardless of significance of individual variables within the domain This approach was taken as variables ... and age as random effects, neither of the variance components remained statistically significant However, the change in deviance and AIC values comparing the final random intercept model and the...
- 13
- 274
- 0
báo cáo khoa học: " The implementation of a translational study involving a primary care based behavioral program to improve blood pressure control: The HTN-IMPROVE study protocol " pot
... Education Clinical Center (GRECC), HSR&D Targeted Research Enhancement Program for Patient Healthcare Behavior, and Clinical Research Center of Excellence (CRCoE), and the Department of Medicine, ... secular trends in hypertension management practices and clinical outcomes Data collection strategy We obtain quantitative data from the intervention software on the clinics' actual use of the ... conceptual model Likewise, quantitative data are aggregated to the VA clinic level and analyzed in conjunction with qualitative data using pattern-matching logic Using the ACIC data, we examine whether...
- 13
- 259
- 0
Báo cáo y học: " Severe hydrops in the infant of a Rhesus D-positive mother due to anti-c antibodies diagnosed antenatally: a case report" pot
... However, the combination of anti -c and anti-E antigens can cause the occurrence of severe fetal and neonatal haemolytic disease [3] The management of anti -c isoimmunisation or isoimmunisation with any ... the antenatal care of the mother, carried out the literature search and wrote the manuscript SK, KR, JBS and GK helped in managing the case and in providing the final draft of the manuscript All ... behalf of the infant for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Abbreviations DCT:...
- 4
- 408
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... nature of the PSW contacts with participants It will also ensure that the research team are fully aware when discharge planning commences and the exact point of discharge for each participant and ... R: What consumers say they want and need during a psychiatric emergency? Journal of Psychiatric Practice 2003, 9:39-58 16 Castelain S, Bruggerman S, van Busschbach JT, Gaag M van der, Stant AD, ... that subject allocation to the treatment groups is approximately equal Once randomisation has taken place the statistician will contact the project coordinator (JR) who will provide the relevant...
- 7
- 443
- 0
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx
... psychiatric nurse, access to social worker and to psychologist, occupational therapist, dual diagnosis psychiatrist, varied access to occupational therapist and outpatient service psychologist another ... Ethnicity x2 -1.52 % *Mixed refers to participant with mixed African-Caucasian ancestry Black refers to black African participants **Participants who live within the city limits of the City of Cape ... strengthen the service it provided, such as access to day centres, occupational therapy assessments and coordination of medication issuing One major disadvantage of the teams’ location was the...
- 8
- 310
- 0
báo cáo khoa học: " A qualitative assessment of stakeholder perceptions and socio-cultural influences on the acceptability of harm reduction programs in Tijuana, Mexico" ppsx
... contributions MMP contributed to the data collection, analysis and drafting of the manuscript RL and AM aided in the collection and analysis of interview data CAL participated in the design of ... Russia Tkatchenko-Schmidt et al [24] found that a key barrier to harm reduction scale-up was cultural unacceptability, and was related to two factors; the legacy of policies of the communist past ... reflect new information The analyses focused on generating themes such as acceptance of harm reduction in the Mexican context, cultural and political barriers to implementation, and the socio-cultural...
- 9
- 310
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... reference material for HCV RNA 2.26 × 103 IU/ml National reference material for HCV RNA 2.26 × 102 IU/ml IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct HCV ... Primers/probes used in the study Primer/probe Primer/probe sequence (5' 3') Position As 5'-GAGTAGTGTTGGGTCGCGAA-3' 256 275 Aa 5'-GTGCACGGTCTACGAGACCTC-3' 320 340 Ap FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ 292...
- 9
- 322
- 0
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
... impact of variation in the training data on the weight vector that is estimated by regression analysis This feature is of practical importance because technical noise arising from the transcript ... the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values for N genes An N × T matrix ... connections The other metrics are the Precision-Recall (PR) and Receiver Operating Characteristics (ROC) curves are not available for the INSILICO3 dataset The predicted networks by LP-SLGN can...
- 15
- 392
- 0
- the components of a c program
- the design of a training programme measurement model
- the game of nim c programming
- features of a c programming language
- the anatomy of a web application
- understanding the anatomy of a flex application
- 1 the anatomy of a computer object
- the anatomy of a database system
- sharing names among the parts of a java program
- 12 including the output of a cgi program
- trial version section 7 6 memory layout of a c program
- the anatomy of an hla program
- the anatomy of a dialog
- the anatomy of a federal contract dispute
- the tools of a computer programmer
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008