strategies for circumventing genome complexity in a polyploid plant

Space sharing strategies for storage yard management in a transshipment hub port

Space sharing strategies for storage yard management in a transshipment hub port

Ngày tải lên : 09/09/2015, 10:14
... containers in separate areas For transshipment hubs, the loading and discharging activities are both in large batches and happen simultaneously within the same storage yard This makes the storage ... storage strategies are proposed in this thesis, namely the “partial space-sharing strategy” and the “flexible space-sharing strategy” In the “partial space-sharing strategy”, part of the storage ... sharing and non-sharing space  Based on the findings from the “partial space-sharing strategy”, a more advanced storage strategy is proposed, namely the “flexible space-sharing strategy” In...
  • 158
  • 331
  • 0
Tài liệu StrategieS for SucceSS: How to Write a Grant in Cancer CAM docx

Tài liệu StrategieS for SucceSS: How to Write a Grant in Cancer CAM docx

Ngày tải lên : 14/02/2014, 22:20
... Cambodia, China, India, Japan, Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, and Vietnam Assurance, Institutional Assurance of Protection for Human Subjects See Institutional Assurance ... Subpopulations Valid Analysis White Women, see Gender American Indian or Alaska Native A person having origins in the original peoples of North, Central, or South America who maintains tribal affiliation ... Approach to CAM Interventions: Discuss advantages and disadvantages of each approach Provide compelling rationale for choice Consider integrating individualized approach within standardized format...
  • 61
  • 517
  • 0
báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx

báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx

Ngày tải lên : 10/08/2014, 11:20
... social influence and leadership, will be more effective in increasing hand hygiene compliance rates compared to a state-ofthe-art strategy, mainly addressing the individual and organisational ... strategy Page of includes all of the above elements of the state-of-the-art strategy as well as: gaining active commitment and initiative of ward management; modelling by informal leaders at ... particularly alcohol-based hand disinfection • Informal leaders models social skills in addressing behaviour of colleagues • Interviews and messages in newsletters or hospital magazines • Informal...
  • 9
  • 521
  • 0
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Ngày tải lên : 13/08/2014, 01:20
... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p-env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272 *********************************************.********************** ... 643:CAGGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGAGAGAACAATGAAGAAGAGGCGGC 642:CCTGATAGCGGCGGACCTCTCATTGATCTTCTCACAGAGGACCCCCCCGCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC...
  • 7
  • 349
  • 0
Tài liệu Báo cáo khoa học: Computational processing and error reduction strategies for standardized quantitative data in biological networks doc

Tài liệu Báo cáo khoa học: Computational processing and error reduction strategies for standardized quantitative data in biological networks doc

Ngày tải lên : 19/02/2014, 07:20
... reduction and to develop reliable algorithms for data processing, facilitating the generation of high-quality data by quantitative immunoblotting Strategies for standardizing quantitative data Results ... show that by randomized sample loading and computational data processing, including criteria-based normalization, high-quality quantitative data can reliably be generated by immunoblotting, a FEBS ... GST-EpoR, indicating that the antibody was in large excess compared with HA-EpoR Using this data, we calculated that 40 ng of GST-EpoR should be added to lysates to obtain comparable signals for HA-EpoR...
  • 12
  • 467
  • 0
THE OLD GIRLS'''' NETWORK: Insider Advice for Women Building Businesses in a Man''''s World doc

THE OLD GIRLS'''' NETWORK: Insider Advice for Women Building Businesses in a Man''''s World doc

Ngày tải lên : 05/03/2014, 20:20
... to make a living • Distinguish between an actionable dream and a fleeting fantasy • There are many ways to translate your passion into an idea for a business If your passion doesn't appear at ... outsourcing was a natural Her company would manage and host the application as a remote monitoring system rather than have customers buy, install, and maintain an entire software program that could ... their information secure—and have a safe place to buy and sell, to engage in financial transactions, and to store sensitive data and medical records Within a span of three years, just about every...
  • 255
  • 507
  • 0
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

Ngày tải lên : 08/03/2014, 02:21
... of automating the generation of annotation and metadata databases to enhance search and browsing of meeting recordings This goal can be achieved by providing plugand-play databases, which are ... generates the global tab-separated files for each annotation The script also generates an SQL script that creates a relational annotation database and populates it with data from the tab-separated ... for various annotations and/or table formats 4 Metadata: Generation of Explicit Files and Conversion to Tabular Format As mentioned in Section 2, metadata denotes here any static information about...
  • 4
  • 373
  • 0
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Ngày tải lên : 15/03/2014, 01:20
... United States United Kingdom Italy France China Australia Japan Russian Federation Canada Brazil Germany Turkey South Korea India South Africa Indonesia Mexico Argentina G20 countries' total 2010b) ... a) Based on banks contained in respective countries' Datastream bank indices Note that such data are not available for Saudi Arabia b) From 1-Jan-10 to 29-Jul-10 c) Based on banks contained in ... RISKS AHEAD FOR THE FINANCIAL INDUSTRY IN A CHANGING INTEREST RATE ENVIRONMENT A Current financial market outlook and risks Selected recent developments Financial markets are searching for direction,...
  • 18
  • 384
  • 0
Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

Ngày tải lên : 31/03/2014, 01:20
... with 10K, 20K and 40K training data 3.4 Training Data The training data includes manually annotated 3625 sentences (approximately 40,000 words) for both supervised HMM and ME model A fixed set ... only a small amount of labeled training text is available We shall call these new models HMM-S+MA, HMM-SS+ MA and ME+MA 222 Our MA has high accuracy and coverage but it still has some missing ... training data to understand the relative performance of the models as we keep on increasing the size of the annotated data 3.1 Test Data All the models have been tested on a set of randomly drawn...
  • 4
  • 455
  • 0
Research and Training Strategies for Goat Production Systems in South Africa pptx

Research and Training Strategies for Goat Production Systems in South Africa pptx

Ngày tải lên : 31/03/2014, 22:20
... crafters than tanners Training Training has started in a small way in Grahamstown through the Department of Labours initiative and some 80 Eastern Cape people have received 15 days of basic leatherwork ... cultivated earlier By far the majority of old lands are presently used for grazing in Dyamala *** The grazing area is increasingly encroached upon by an ever-expanding residential area This is exacerbated ... has already been said about goat leather The major points in its favour are: It is readily available throughout most parts of South Africa and particularly in the rural areas of the Eastern Cape,...
  • 128
  • 557
  • 0
Giáo trình thực hành BCMSN   Chương 7 – Planning for Implementation of Voice in a Campus

Giáo trình thực hành BCMSN Chương 7 – Planning for Implementation of Voice in a Campus

Ngày tải lên : 08/05/2014, 13:41
... Planning for Implementation of Voice in a Campus Cấu hình interface trunk SW3560_01 SW3560_01(config)#interface range gigabitEthernet 0/1 - SW3560_01(config-if-range)#switchport trunk encapsulation ... (config-line)# login SW3560_01 (config)#line vty SW3560_01 (config-line)# password cisco SW3560_01 (config-line)# login Bước 2: Cấu hình trunk cho interface Fa0/1 Fa0/2 switch Cấu hình interface trunk ... (config-vlan)#vlan 40 SW2950_01 (config-vlan)#name VLAN40 SW2950_01 (config-vlan)#end Cấu hình VLAN SW2950_02 SW2950_02 (config-vlan)#name VLAN20 SW2950_02 (config-vlan)#vlan 40 SW2950_02 (config-vlan)#name...
  • 12
  • 457
  • 0
Chương 8 – Planning for Implementation of Voice in a Campus

Chương 8 – Planning for Implementation of Voice in a Campus

Ngày tải lên : 08/05/2014, 13:41
... 8.1.5 Auxiliary VLANs Hình 8.1.5-1: Các Auxiliary VLAN che phủ mạng liệu Một số switch Cisco Catalyst cung cấp tính độc đáo gọi " auxiliary VLAN" "voice VLAN" Auxiliary VLAN cho phép ta che phủ ... sau đây: 248 Giáo trình kh a học BCMSN Chương – Planning for Implementation of Voice in a Campus Hình 8.2.2-1: Phân loại đánh dấu traffic Thông số Layer 2: đ a MAC, Multiprotocol Label Switching ... cho tất interface AutoQoS có lợi cho trường hợp sau đây: 253 Giáo trình kh a học BCMSN Chương – Planning for Implementation of Voice in a Campus Các doanh nghiệp v a nhỏ muốn triển khai điện...
  • 21
  • 427
  • 0
báo cáo hóa học:" Alternative antiretroviral monitoring strategies for HIV-infected patients in east Africa: opportunities to save more lives?" potx

báo cáo hóa học:" Alternative antiretroviral monitoring strategies for HIV-infected patients in east Africa: opportunities to save more lives?" potx

Ngày tải lên : 20/06/2014, 08:20
... Value of alternative laboratory monitoring strategies compared to earlier treatment initiation, assuming three antiretroviral (ARV) regimens are available Monitoring strategy Freq- Viral load ... treatment availability scenarios Second, routine viral load testing alone is only a preferred strategy at levels of willingness to pay that far Braithwaite et al Journal of the International AIDS ... sub-Saharan Africa and North America: a meta-analysis JAMA 2006, 296:679-690 Yiannoutsos CT, An MW, Frangakis CE, Musick BS, Braitstein P, WoolsKaloustian K, et al: Sampling-based approaches to...
  • 13
  • 320
  • 0
Báo cáo hóa học: " Research Article Exploring Landmark Placement Strategies for Topology-Based Localization in Wireless Sensor Networks" pot

Báo cáo hóa học: " Research Article Exploring Landmark Placement Strategies for Topology-Based Localization in Wireless Sensor Networks" pot

Ngày tải lên : 22/06/2014, 00:20
... performance, avoiding the need of equally distant landmark placement We also notice again that as the number of landmarks increases up to a certain threshold, considerable performance gains are ... that point, the curve “flattens out,” that is, the gains of adding more landmarks decrease as the number of landmarks increases As part of future work, we plan to analyze this behavior analytically ... EURASIP Journal on Advances in Signal Processing [13] A Rao, S Ratnasamy, C Papadimitriou, S Shenker, and I Stoica, “Geographic routing without location information,” in Proceedings of the 9th Annual...
  • 12
  • 292
  • 0
Báo cáo hóa học: " Research Article Measurement Combination for Acoustic Source Localization in a Room Environment" ppt

Báo cáo hóa học: " Research Article Measurement Combination for Acoustic Source Localization in a Room Environment" ppt

Ngày tải lên : 22/06/2014, 00:20
... source In contrast, MAP and median SIMULATION AND RECORDING SETUP A dialogue situation between talkers is analyzed The localization methods already discussed are compared using simulations and real-data ... was applied due to its favorable resampling quality and low computational complexity [34] The particles are confined to room dimensions and in the real-data analysis also Pasi Pertil¨ et al a ... 3013–3016, Salt Lake City, Utah, USA, May 2001 J.-M Valin, F Michaud, and J Rouat, “Robust localization and tracking of simultaneous moving sound sources using beamforming and particle filtering,” Robotics...
  • 14
  • 298
  • 0
Báo cáo hóa học: " Research Article Prerouted FPGA Cores for Rapid System Construction in a Dynamic Reconfigurable System" pot

Báo cáo hóa học: " Research Article Prerouted FPGA Cores for Rapid System Construction in a Dynamic Reconfigurable System" pot

Ngày tải lên : 22/06/2014, 22:20
... policy layer provides a mechanism to share border crossing wires to maintain a good internal wire bandwidth WIN and an appropriate interface bandwidth WIF to the interface layer as shown in Figure ... direction An interface instance assigned to a particular border edge location is a port An assigned interface is created by optimizing the signal ordering and mapping them to the wires made available ... (BLC), a set of interface signals, and a set of interface definitions The interface definitions are described in XML and provide an absolute wire assignment for each signal in an interface Mapping an...
  • 7
  • 307
  • 0
Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Ngày tải lên : 23/06/2014, 01:20
... Van Dyck, and A Soltanian, “Interference of bluetooth and IEEE 802.11: simulation modeling and performance evaluation,” in Proc 4th International ACM Workshop on Modeling, Analysis and Simulation ... identification strategies for reconfigurable software-defined radio-based terminal His research interests are in mode identification algorithms for software-defined radio platform in a single and multiuser ... transmit a large number of modes in different bands The SDR approach is a great evolution based on the programmable digital radio (PDR) paradigm, which consists in a radio fully programmable in baseband...
  • 13
  • 455
  • 0
Báo cáo lâm nghiệp: "Screening for efficient cold hardening in a breeding population of Salix using near infrared reflectance spectroscopy" pps

Báo cáo lâm nghiệp: "Screening for efficient cold hardening in a breeding population of Salix using near infrared reflectance spectroscopy" pps

Ngày tải lên : 08/08/2014, 01:21
... investigation was to look for such a combination in a cross between an early-and-rapidly hardening clone and a late-and-slowly hardening one Traits were partially recombined in the F2 offspring, ... method for determining cold hardiness is best applied to intact tissues undergoing initial cold hardening, and by utilising information in both the visible and near infrared spectral ranges 4.2 Inheritance ... between a late-and-slowly hardening clone and an early-and-rapidly hardening one; and to test the value of the spectral technique for diagnosing cold hardiness in a breeding situation MATERIALS AND...
  • 6
  • 235
  • 0
Báo cáo y học: "Provider-initiated HIV testing in rural Haiti: low rate of missed opportunities for diagnosis of HIV in a primary care clinic" ppsx

Báo cáo y học: "Provider-initiated HIV testing in rural Haiti: low rate of missed opportunities for diagnosis of HIV in a primary care clinic" ppsx

Ngày tải lên : 10/08/2014, 05:20
... F, Mayanja-Kizza H, Bangsberg DR: HIV counseling and testing practices at an urban hospital in Kampala, Uganda AIDS Behav 2006, 10(4):361-367 MacDonald SR, Skor A, Socol ML, Garcia PM: Human immunodeficiency ... HIV in 15–49 year olds as 1.6% [12] In 2002, when the Global Fund to Fight AIDS, TB and Malaria called for applications, Partners In Health – a non-profit organization affiliated with Harvard ... rural, resource-limited clinic setting in Haiti after staff was trained and primary care services were reinforced This demonstrates the success of a rural HIV testing program that is integrated...
  • 5
  • 460
  • 0