steps involved in filling a prescription
Báo cáo y học: " Mitogen-activated protein kinases and NFκB are involved in SP-A-enhanced responses of macrophages to " pdf
Ngày tải lên :
12/08/2014, 14:20
... of the STAT pathway, PI3K/Akt pathway and mitogen-activated protein (MAP) kinase family [10-12] MAP kinases are a family of serine/threonine kinases that are activated by phosphorylation of conserved ... by rat macrophages in response to BCG through increased activation of intra-macrophage signalling pathways involving MAP kinases and NFκB We have examined the role of both the MAPK pathway and ... protein kinase; (JNK): c-Jun amino terminal kinase; (LPS): lipopolysaccharide; (LAM): lipoarabinomannan; (NFκB): nuclear factor κB; (SP -A) : surfactant protein A; (RBMM): rat bone marrow macrophages;...
- 11
- 435
- 0
10 steps in developing a strategic social media plan for your business
Ngày tải lên :
07/01/2014, 15:27
... track Capture multiple analytics as some metrics may later become a better KPI af ter you have had the experience of measuring and analysing the data Roll out st rat egy Once you have f inalized ... of social media at solving that problem Choose a metric that’s indicative of that goal’s progress and is easy to measure Social media evolves rapidly so your tactics may have to change later T ... need to develop a social media strategy that will generate meaningf ul and real returns f or the business T he 10 steps in developing a strategic social media are: Align with the business Discover...
- 6
- 834
- 0
The 10 Steps In Developing A Strategic Social Media Plan For Your Business
Ngày tải lên :
08/02/2014, 20:25
... goals and their associated KPIs will vary Speak with and analyse the requirements of each department and work out what level of resource is available f or social media # Def ine goals Analyse any ... buy -in f rom individual departments and management Add timelines and assign tasks Identif y and provide any required training/tools/supports Agree and manage roll out Only sign of f af ter the above ... levels are f ar more ef f ective at measuring social media ROI and they will be resilient to any tactical changes # Assign values t o KPIs Work with each department to analyse and assign a monetary...
- 5
- 460
- 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
Ngày tải lên :
15/02/2014, 01:20
... TAG AGC AGG GTA GGT TGA TTT CAT GTC GAA TG-3¢; additional XbaI site underlined) and OB (5¢-AAA AGA ATT CTT AGA AGT CCC AGT CAT CGT C-3¢; additional EcoRI site underlined) The amplified PCR fragment ... was used as internal standard for all measurements For GF-AAS measurements, an AAS5 EA system (Carl Zeiss GmbH, Jena, Germany) was used Manganese was determined at a wavelength of 279.8 nm and ... gene was sequenced by a primer walking approach For DNA analysis, dnastar software (DNASTAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & Educational Software, Cary, NC, USA) were...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt
Ngày tải lên :
19/02/2014, 16:20
... related to pAO1 c-N-methylaminobutyrate oxidase (MABO) and UV-visible spectra of wild-type and mutant MABO proteins (A) Amino acid alignment Amino acids identical among MABO and one of the related ... ninhydrine reagent Lane 1, lL of a mM amino acid mix (from bottom to top: oxidized glutathion, lysine, alanine and leucine) employed as a standard An amino acid alignment of the N-terminal sequence ... MABO Fig The ORF63 protein is a demethylating c-N-methylaminobutyrate oxidase (MABO) (A) MABO analysed by PAGE on nondenaturing 10% (w/v) polyacrylamide gels and stained with Coomassie brillant...
- 8
- 647
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with a rabbit antiserum directed against recombinant C reinhardtii CP12 (1 : 2000) or a rabbit antiserum directed against recombinant C reinhardtii GAPDH (1 : 5000) Antibody binding was revealed...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
Ngày tải lên :
20/02/2014, 03:20
... et al 18 Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts Anaerobe ... 19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M, Inomata M, Hayashi M, Iwashita S, Slot JW & OhnoIwashita Y (2001) Selective binding of perfringolysin O derivative to cholesterol-rich membrane ... PAGE, transferred to an Immobilon-P membrane and visualized using ECL plus (Amersham Bioscience, Piscataway, NJ, USA) 10 Others Proteins were analysed using a bicinchoninic acid protein assay kit...
- 10
- 588
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
Ngày tải lên :
21/02/2014, 01:21
... S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C content at ... are indicated by dotted lines Putative translation initiation and termination codons are in bold letters The start and direction of each ORF are indicated by horizontal arrows and named accordingly ... enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 as described [30], except that starch was used instead...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt
Ngày tải lên :
22/02/2014, 07:20
... recombinants in a cross involving strain IJ2 (sta2-29::ARG7 sta3-1) and an interfertile ecotype of C reinhardtii known as C smithii (strain CS9) This latter is wild-type regarding starch accumulation ... 4–16 and 21–29 correspond to independent recombinant strains obtained from a cross involving CS9 and IJ2 parental strains ability of GBSSI to extend amylopectin outer chains Again this coincides ... obtain more information about the 5¢ end of this cDNA, an RT-PCR amplification was done using a specific primer 5¢-CGCAAACACCTCGCTGGCAC and a degenerated primer 5¢-AAGACSGGYGGYCT corresponding...
- 11
- 556
- 0
Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt
Ngày tải lên :
06/03/2014, 00:21
... Yamazaki A, Yu H, Yamazaki M, Honkawa H, Matsuura I, Usukura J & Yamazaki RK (2003) A critical role for ATP in the stimulation of retinal guanylyl cyclase by guanylyl cyclase-activating proteins ... 33150–33160 Yamazaki A, Yamazaki M, Yamazaki RK & Usukura J (2006) Illuminated rhodopsin is required for strong activation of retinal guanylate cyclase by guanylate cyclase-activating proteins Biochemistry ... GAF domains in amphibian rod photoreceptor cGMP phosphodiesterase (PDE) Identification of GAF domains in PDE alphabeta subunits and distinct domains in the PDE gamma subunit involved in stimulation...
- 19
- 406
- 1
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx
Ngày tải lên :
06/03/2014, 00:21
... called GWD2 in Arabidopsis, is extraplastidial and has no apparent role in starch degradation [10] The plastidial a- amylase AMY3 is not required for normal transitory starch metabolism in Arabidopsis ... capacity [29] The CBM45s are present as tandem domains in the N-terminal part of StGWD and AtAMY3 and separated by a linker of approximately 200 and 50 amino acids, respectively (Fig 1A) The alignment ... Starch-binding domains in the CBM45 family M A Glaring et al branch points Together, these polymers are laid down as alternating semicrystalline and amorphous layers to form the supramolecular...
- 11
- 634
- 0
Báo cáo khoa học: A novel prokaryotic L-arginine:glycine amidinotransferase is involved in cylindrospermopsin biosynthesis potx
Ngày tải lên :
06/03/2014, 22:21
... l-Alanine, b-alanine, c-aminobutyric acid, ethanolamine, taurine, l-lysine, a- amino-oxyacetic acid and l-norvaline were used as amidino group acceptors The limit of detection for the assays was ... Isolation Kit (MoBio, Carlsbad, CA, USA), according to the manufacturer’s instructions PCR amplification of cyrA was performed using primers cyrA-F (5¢-CATATGCAAACAGAATTGTAAATAGCT3¢) and cyrA-R ... enzymes utilized for arginine degradation in prokaryotes are arginase, arginine deiminase, arginine succinyltransferase and arginine oxidase [45,46] The substrate specificity of CyrA could not be predicted...
- 17
- 544
- 0
Medical Marketing in the United States: A Prescription for Reform pdf
Ngày tải lên :
07/03/2014, 00:20
... medical education seminars take place at reasonable venues and focus on the educational aspect of the gathering Paragraph (h)(2)(C) attempts to place reasonable boundaries around speaking arrangements ... travel, lodging, or otherwise are made directly to a covered health entity (C) Speaking Arrangements and Training Meetings— (i) A speaking arrangement or training meeting venue and accommodations ... pitfalls of medical marketing by issuing their own guidelines Two organizations in particular have issued broad regulations pertaining to medical marketing: the American Medical Association (“AMA”)...
- 33
- 661
- 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
Ngày tải lên :
08/03/2014, 23:20
... b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ATTTCCTGTTG-30 ... Luffa cells by guanidine thiocyanate/hot phenol extraction [24] Poly (A) -rich RNA was purified by an mRNA purification kit (Pharmacia), and a Luffa cDNA library was constructed using a lZAP-cDNA synthesis ... Pfu DNA polymerase (Stratagene) used as the DNA polymerase Two primers of 50 -CTGGTACCGATTGAGTTGAGGTG ATTG-30 (Kpn I site underlined) and 50 -CCTCTAGAGTA AAAGTCTCCAATC-30 (Xba I site underlined)...
- 7
- 491
- 1
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
Ngày tải lên :
16/03/2014, 06:20
... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢ Actin fractionation ... believed to interact indirectly with the actin cytoskeleton via intermediary proteins, such as zyxin and a- actinin, recent studies have shown that CRP1 and CRP2 are autonomous actin-binding proteins...
- 11
- 347
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
Ngày tải lên :
16/03/2014, 23:20
... According to the sequence obtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average ... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the ... cross-reactivity with antisera raised against C acidovorans XDH Activity staining with xanthine/Nitro Blue tetrazolium of native gels containing equal levels of activity (10 lU) of recombinant and native...
- 11
- 584
- 0
Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot
Ngày tải lên :
17/03/2014, 17:20
... amino-acid recognition and their activation as an aminoacyl adenylate, and the peptidyl carrier domain (PCP-domain or T-domain) C-terminal to the A- domain providing a covalently bound 4¢-phosphopanthetheine ... stand-alone A- domain that activates b-lysine by adenylation It was also found that S noursei harbours a protein that after activation speci®cally binds b-lysine as a thioester This protein contains ... carboxylic acids or an amino acid such as alanine as adenylates, which in turn are loaded to speci®c PCP domains These PCPdomains are either alone-standing PCPs, as in the biosynthesis of actinomycin...
- 11
- 559
- 0
Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
Ngày tải lên :
23/03/2014, 03:20
... were as follows: CIDEC, 5¢-TTGATGTGGCCCGT GTAACGTTTG-3¢ and 5¢-AAGCTTCCTTCATGATGCG CTTGG-3¢; PPARc, 5¢-TGGAATTAGATGACAGCGAC TTGG-3¢ and 5¢-CTGGAGCAGCTTGGCAAACA-3¢; glyceraldehyde-3-phosphate dehydrogenase ... dehydrogenase (GAPDH), 5¢-AAC ATCATCCCTGCCTCTAC-3¢ and 5¢-CTGCTTCACCACC TTCTTG-3¢; perilipin, 5¢-CCTGCCTTACATGGCTTGTT-3¢ and 5¢-CCTTTGTTGACTGCCATCCT-3¢; and adipophilin, 5¢-CTGAGCACATCGAGTCACATACTCT-3¢ ... a target of PPARc transactivation These data suggest that CIDEC may not only be a downstream target of PPARc transactivation, but is also likely to be involved in a feedback-sensing pathway The...
- 11
- 513
- 0
Báo cáo khoa học: dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis pot
Ngày tải lên :
23/03/2014, 07:20
... protein standards, and the reference proteins catalase (232 kDa), aldolase (158 kDa), BSA (68 kDa) and ovalbumin (43 kDa) were obtained from Pharmacia Biotech (Uppsala, Sweden) l-Galactono-1,4-lactone, ... mature AtGALDH (amino acids 102610) was PCR amplied from A thaliana (ecotype Columbia) seedling cDNA, using the oligonucleotides AtGALDH_fw102 (5Â-GGAATTCCATATG TACGCTCCTTTACCTGAAG-3Â) and AtGALDH_rv ... Recombinant AtGALDH migrated in SDS PAGE as a single band with an apparent molecular mass of approximately 55 kDa (Fig 3) This value is in fair agreement with the calculated molecular mass (58.8...
- 14
- 333
- 0