steady state output of a system

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Ngày tải lên : 29/03/2014, 09:20
... per- formance of the GAL system. As KlGal1p plays a dual role, as both inducer and galactokinase, our analysis indicates that only 10% of total KlGal1p translocates into the nucleus to act as inducer, ... used a steady- state modeling approach to quan- tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ level understanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi- mentally by obtaining steady- state protein expression levels in a wild-type strain and in a mutant strain lack- ing gene KlGAL80. The steady- state...
  • 16
  • 371
  • 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Ngày tải lên : 20/06/2014, 22:20
... (M 1 ), a microphone pre-amplifier (Amp. B) and an analog-to-digital converter (A/ D) of the input /output card. The recorded digital data were stored in a file on a hard disk that could be read by ... been of interest with regard to the fact that practical systems have a limited dynamic range. However, the synthesis of test signals that allow enforcing a signal feature like modulation has only ... based on digital signal processing and thus assume that test stimuli and the output signal of the system under test are available as digital waveforms, as showninFigure2whereonedigitalwaveformx enters the...
  • 20
  • 415
  • 0
Tài liệu Steady State Operation of DC Machines pptx

Tài liệu Steady State Operation of DC Machines pptx

Ngày tải lên : 17/12/2013, 14:15
... R V kI R kI T IVR V kI R kI T aaafaaaafa efafaf a a f a f e fn fn f an fn a fn e =+ = + ị = == = = = () () 2 2 If both voltages have rated values then (13) Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equal to rated. Calculate rated torque and rated power of the machine whose data are given. If the motor now drives a load such that the armature ... the two calculated points. Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
  • 12
  • 527
  • 1
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20
... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....
  • 35
  • 481
  • 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Ngày tải lên : 21/02/2014, 15:20
... obtained for the glutaminase reaction in the presence of 0.1 m M each of UTP and ATP-cS (data not shown). Apparently, the value of K a , k cat,1 and k cat,2 were similar regardless of the active ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrate concentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activated CTP synthesis, if the enzyme was incubated in the presence of GTP, UTP and the nonhydrolyzable ATP analog ADPNP [8]....
  • 8
  • 698
  • 0
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

Ngày tải lên : 08/03/2014, 04:22
... Treebank, produce syntactic parse trees with bare phrase labels, such as NP, PP, S, although the training corpora are usually much richer and often contain additional grammatical and semantic ... is desirable to have parsers produce gram- matically and semantically rich output. Second, to facilitate dependency-based comparison and evalu- ation of different parsers, their outputs may need ... given an occur- rence of a pattern and the features of all the nodes involved. We trained a separate classifier for each pattern. For evaluation purposes we extracted all occur- rences of the patterns...
  • 8
  • 379
  • 0
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Ngày tải lên : 09/03/2014, 00:20
... larger capacity and labor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner. The types of a refiner are a conical type, a drum type and a disc ... when a great amount of this high-temperature exhaust gas is cooled by the heat exchanger. At the same time, the heat contained in the gas can be recovered as hot water. Scales and pulps are attached ... is decreased by increasing the differential pressure of the exhaust gas. Pulps are attached to the jet condenser which absorbs a great amount of gas and the thermal accumulator. Pulps also enter...
  • 45
  • 1.4K
  • 0
Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx

Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx

Ngày tải lên : 18/03/2014, 02:20
... must all agree in their output. A careful analysis also shows that Church's allophonic parser, in his actual implementation using matrix operations to simulate bottom up chart parsing, can ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...
  • 7
  • 333
  • 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Ngày tải lên : 30/03/2014, 20:20
... TGAGGAGGGACAAAACCTTGAA 700 Reverse TCGGTCACTGCCAGCATTC 700 Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100 RanGTPase S83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300 Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150 Cks2 NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700 Reverse ATATGCGGTTCTGGCTCATGA 700 Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150 RanBP1 NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100 Cyclin D2 NM_009829 Forward CGTACATGCGCAGGATGGT 700 Reverse AATTCATGGCCAGAGGAAAGAC 300 Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100 Cyclin D3 NM_007632 Forward AAAGGAGATCAAGCCGCACAT...
  • 13
  • 338
  • 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx

báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx

Ngày tải lên : 18/06/2014, 17:20
... structures and interactions of feedback loops, and consists of variables for cause and effect, and causal links. A causal link con- nects a cause variable with an effect variable by a link with a positive ... 2000. 16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance Point International Review of Health Workforce Planning Health Human Resources Strategies Division. Health Canada; 2001. 17. ... num- ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams, especially of two types: causal loop, and stock and flow. Causal loop A causal-loop diagram identifies...
  • 9
  • 543
  • 1
Simulation of a Multiple Input Multiple Output (MIMO) wireless system

Simulation of a Multiple Input Multiple Output (MIMO) wireless system

Ngày tải lên : 20/11/2012, 11:36
... contains all of the data about rays propagating from a base station to a field point. Each field point has a ray list associated with it. A ray list is defined by the class ‘ray_list.hh’ and ... originally developed for applications in radar and sonar systems. Using multiple antennas introduces spatial diversity into the system. These antennas are also known as ‘smart antennas’. Spatial ... it is passed a particular base station, an image and its order, and also the field point. As seen earlier a ray is made up of nodes, two of these nodes are always the base station and the field...
  • 73
  • 459
  • 1
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... power system and the batteries are b inary, but they are all multi -state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. ... than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached. ... Reliability Analysis of a Power System Based on the Multi -State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha,...
  • 4
  • 407
  • 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Ngày tải lên : 07/03/2014, 16:20
... of galactose signal transduction (Eur. J. Biochem. 271) 4073 A steady- state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae Malkhey ... detail ed mechanisms include the tryptophan and arabinose systems of Escherichia coli and the phage lambda switch in bacteriophage. The GAL regulatory network in Saccharomyces cerevis- iae is a ... mechanism was based on comparing the input (galactose concentration) output (fractional pro- tein expression) steady- state responses for the candidate models with experimental data reported and...
  • 11
  • 490
  • 0

Xem thêm