steady state output of a linear system

Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx

Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx

Ngày tải lên : 22/06/2014, 22:20
... (33) and in (34) provide accurate estimates of the steady- state MSE and of the steady- state A Carini and G L Sicuranza Table 3: First eight coefficients of the MMS solution (wo ) and of the asymptotic ... vec−1 {Fi σ } Steady- state behavior We are here interested in the estimation of the mean-square error (MSE) and the mean-square deviation (MSD) at steady state The adaptation rule of (15) provides ... Theoretical (- -) and simulation values (–) of steady- state MSE versus step-size of the FX-PE-AP algorithm (a) at even samples with a nonlinear controller, (b) at odd samples with a nonlinear controller,...
  • 15
  • 311
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches ... branches are all above 5800 mAh, the system is reliable because the required capacity is reached But when we analyze the system reliability using the traditional system reliability theory, the system ... reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi -state system The multistate system theory can define...
  • 4
  • 407
  • 0
Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

Ngày tải lên : 29/03/2014, 09:20
... the GAL systems of K lactis and S cerevisiae are as follows: (a) the autoregulation of transcriptional activator KlGal4p; (b) the dual role of KlGal1p as a metabolizing enzyme as well as a galactose-sensing ... 100 KlGal4pt (μM) 101 Fig (A) Time course of fractional b-galactosidase expression in a mutant strain lacking KlGAL80 A typical fed-batch operation aimed at maintaining an average steady- state glucose ... FEBS V R Pannala et al were tabulated as the steady- state fractional protein expressed at different average steady- state glucose ⁄ galactose concentrations Substrate and enzyme activity measurements...
  • 16
  • 371
  • 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc

Ngày tải lên : 20/06/2014, 22:20
... used measurement procedure assumes a system that is timeinvariant or has at least reached a steady- state condition in which it behaves like a time-invariant system The exemplarily demonstrated ... should ensure that the stimulus of variable modulation spanned Table Parametrization of measurements Choice of parameter i as a function of subband number b Type of signal lb and νb ∀i: i = ... compared to cases with an inactive noise reduction subsystem The additional amount of attenuation shall be exactly the steady- state attenuation of the noise reduction subsystem to pass the test of correct...
  • 20
  • 415
  • 0
Báo cáo hóa học: "ASYMPTOTIC BEHAVIOR OF A COMPETITIVE SYSTEM OF LINEAR FRACTIONAL DIFFERENCE EQUATIONS" docx

Báo cáo hóa học: "ASYMPTOTIC BEHAVIOR OF A COMPETITIVE SYSTEM OF LINEAR FRACTIONAL DIFFERENCE EQUATIONS" docx

Ngày tải lên : 22/06/2014, 22:20
... Nurkanovi´ , Asymptotic behavior of a two dimensional linear fractional c c system of difference equations, Radovi Matematiˇ ki 11 (2002), no 1, 59–78 c , Asymptotic behavior of a system of linear ... E is an attractor and ᏷ is a subset of the basin of attraction of E If F is differentiable at a fixed point E, and if the Jacobian JF (E) has one eigenvalue with modulus less than one and a second ... we showed that in cases (5) and (6) an introduction of the positive parameters a and d changed the global behavior of system (1.2) while in case (4) the global qualitative behavior of (1.2) does...
  • 13
  • 268
  • 0
List the components of a radio system

List the components of a radio system

Ngày tải lên : 13/09/2012, 10:52
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... the signal • Attenuation – A loss of signal strength • Multipath distortion – As a radio signal is transmitted, the electromagnetic waves spread out 24 Signal Strength (continued) 25 Radio Frequency ... • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio frequency spectrum Components of a Radio System • Components include:...
  • 30
  • 920
  • 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Ngày tải lên : 05/09/2013, 16:30
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... mathematical optimization Table Results obtained with the genetic algorithm Decision variable Case Case EIS EIS Alternative Alternative Mathematical EIS optimization Alternative EIS Alternative Mathematical...
  • 14
  • 593
  • 0
Tài liệu Steady State Operation of DC Machines pptx

Tài liệu Steady State Operation of DC Machines pptx

Ngày tải lên : 17/12/2013, 14:15
... of a DC motor Standard data that are given for a DC motor on its nameplate are so-called rated values of output power, armature voltage and current, excitation voltage and current, and speed of ... and equal to rated Mechanical losses and iron core losses can be neglected and armature voltage is constant and equal to rated Calculate rated torque and rated power of the machine whose data ... the two calculated points Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
  • 12
  • 527
  • 1
Control of continuous linear systems

Control of continuous linear systems

Ngày tải lên : 01/01/2014, 20:12
... transient and frequency analysis of linear systems Many examples are treated in order to illustrate such an analysis We present a set of approaches to the statement of the frequency response of ... force-momentum balances are also considered: – Mass balances express the fact that the quantity of material entering the system minus the quantity of material leaving it is equal to the accumulation of material ... non -linear systems Recall that the Hammerstein structure consists of a non -linear static system followed by linear dynamics On the basis of the use of the inverse of the non -linear static system, any linear...
  • 356
  • 386
  • 2
Tài liệu Architecture of a Database System ppt

Tài liệu Architecture of a Database System ppt

Ngày tải lên : 20/02/2014, 05:21
... life of a query in a database system This also serves as an overview of the remaining sections of the paper Consider a simple but typical database interaction at an airport, in which a gate agent ... data from the database These operators make calls to fetch data from the DBMS’ Transactional Storage Manager (Figure 1.1, bottom), which manages all data access (read) and manipulation (create, ... there are a wide variety of proprietary database access API sets Some programs are written using embedded SQL, a technique of mixing programming language statements with database access statements...
  • 119
  • 381
  • 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Ngày tải lên : 21/02/2014, 15:20
... the values of kcat,1 and kcat,2, the maximal GTP activation of uncoupled glutamine hydrolysis was about 14-fold (Table 2) At UTP and ATP concentrations of mM each, a 49-fold increase in kcat was ... data from the activation of CTP synthesis or glutaminase activity by GTP as measured spectrophotometrically was analysed using v kcat;1 ẵE ỵ kcat;2 ẵE A KA ỵ A 6ị where kcat,1 and kcat,2 are ... in Table 1, and those obtained for the glutaminase reaction in the presence of 0.1 mM each of UTP and ATP-cS (data not shown) Apparently, the value of Ka, kcat,1 and kcat,2 were similar regardless...
  • 8
  • 698
  • 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Ngày tải lên : 05/03/2014, 14:20
... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... Nguyen Anh Tuan, Nguyen Huy Binh excitation Our new spectrometry system shows many advantages for studying Raman and Fluorescence spectra as well as weak optical signal spectra in general Construction...
  • 6
  • 524
  • 0
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

Ngày tải lên : 08/03/2014, 04:22
... for evaluation on bare labels suggests that our approach is capable not only of adding functional tags, but can also correct the parser’s phrase labels and partof-speech tags: for Collins’ parser ... parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and the Penn Treebank allowed us to recover functional tags (grammatical and semantic), ... but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover the Penn functional tags automatically On the...
  • 8
  • 379
  • 0
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Ngày tải lên : 09/03/2014, 00:20
... was made with a beater before 30 years After that, a larger capacity and labor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner The types of ... gives the material balance and water balance around the papermaking machine in terms of model (wrapping paper of 55 g/m2, with the daily production of 100 tons, and total efficiency of 100%) When ... exchanger At the same time, the heat contained in the gas can be recovered as hot water Scales and pulps are attached to the gas discharging strainers provided on the gas side of the heat exchanger and...
  • 45
  • 1.4K
  • 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc

Ngày tải lên : 30/03/2014, 20:20
... CCAACCACTATATTACACCAATGATGGAGCTGAA 700 700 100 Forward Reverse Probe CAACAAAGTGGATATTAAAGACAGGAAAG TGGCAGAAATGTCATAGTACTGAAGATT AAGGCAAAATCTATTGTCTTCCACCGGAAGAA 300 700 200 Forward Reverse Probe CTGGATTTCCTTTGGGCGTT ... Probe AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 300 500 100 Forward Reverse Probe TCTCCTCACTGGAGTTGATGCA AACGGAACCATCCATTTGACA CTCTATGTCGCACCACTGATAACCTGAGACCTT ... Forward Reverse Probe CCGAAGAGGAGTGGAGGAGACT ATATGCGGTTCTGGCTCATGA CATGTAATGAACCCATCCTAGACTCTGTTGGACA 700 700 150 Forward Reverse Probe TGAGGAGGGACAAAACCTTGAA TCGGTCACTGCCAGCATTC CCAACCACTATATTACACCAATGATGGAGCTGAA...
  • 13
  • 338
  • 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Ngày tải lên : 31/03/2014, 07:20
... transients at 414 nm (Fig 1A) , was taking place over a period of time of at least 1000 s and therefore can be analysed under steadystate conditions Moreover, upon analysing the reaction at shorter ... Time-sequential spectra recorded after addition of CYP1 1A1 to an anaerobic CO-saturated sample containing the reaction mixture FNRrd/Adxox gave rise to a peak at 450 nm together with absorbance decreases ... with Adxox is slow enough to be analysed under steady- state conditions (data not shown) A significant decrease in absorbance at 414 and 450 nm (data not shown) was observed for the reaction of all...
  • 10
  • 400
  • 0
báo cáo hóa học:" From HIV diagnosis to treatment: evaluation of a referral system to promote and monitor access to antiretroviral therapy in rural Tanzania" doc

báo cáo hóa học:" From HIV diagnosis to treatment: evaluation of a referral system to promote and monitor access to antiretroviral therapy in rural Tanzania" doc

Ngày tải lên : 20/06/2014, 08:20
... J, Zaba B, Changalucha J, Kalluvya S, Urassa M: Barriers to accessing antiretroviral therapy in Kisesa, Tanzania: a qualitative study of early rural referrals to the national program AIDS Patient ... cohort in Tanzania XV International Conference on AIDS and STIs in Africa (ICASA) Dakar 2008 Roura M, Wringe A, Busza J, Nhandi B, Mbata D, Zaba B, Urassa M: "Just like fever": a qualitative study ... clinical trial of a vaginal microbicide trial in Mwanza, Tanzania: Understanding the barriers to attending CTC services 15th International Conference on AIDS and STIs in Africa (ICASA), Dakar 2008...
  • 9
  • 586
  • 0
Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt

Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt

Ngày tải lên : 20/06/2014, 21:20
... Existence of solutions of a new system of generalized variational inequalities in Banach spaces Somyot Plubtieng∗ and Tipphawan Thammathiwat Department of Mathematics, Faculty of Science, Naresuan University, ... Singh, SP: An altenate version of a variational inequality Indian J Math 41, 25–31 (1999) 12 Kassay, G, Kolumb´n, J: System of multi-valued variational variational inequalities Publ a Math Debrecen ... Verma, RU: Iterative algorithms and a new system of nonlinear quasivariational inequalities Adv Nonlinear Var Inequal 4(1), 117–124 (2001) 25 Verma, RU: Projection methods, algorithms, and a new...
  • 21
  • 387
  • 0
Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

Ngày tải lên : 21/06/2014, 05:20
... the associated matrix A has an eigenvalue λ such that −λ is also an eigenvalue Since A is a × square matrix, this Advances in Difference Equations obviously implies that the trace of A is also an ... the remainder of the division of xn by the instance, one has that a0 n characteristic polynomial of A Further, by elementary techniques of linear algebra one can also compute them in terms of the ... mapping a1 /ak , a2 /ak , , ak /ak for a1 , a2 , , ak ∈ Rk with given by q a1 , a2 , , ak k k a1 , a2 , , ak , , it is shown in such ak / and : R → R is given by a1 , a2 , , ak...
  • 17
  • 365
  • 0