steady state gain of a closed loop system
Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx
... the GAL systems of K lactis and S cerevisiae are as follows: (a) the autoregulation of transcriptional activator KlGal4p; (b) the dual role of KlGal1p as a metabolizing enzyme as well as a galactose-sensing ... 100 KlGal4pt (μM) 101 Fig (A) Time course of fractional b-galactosidase expression in a mutant strain lacking KlGAL80 A typical fed-batch operation aimed at maintaining an average steady- state glucose ... FEBS V R Pannala et al were tabulated as the steady- state fractional protein expressed at different average steady- state glucose ⁄ galactose concentrations Substrate and enzyme activity measurements...
- 16
- 371
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... memory as a cache of secondary storage data pages The effect of this kind of caching on the performance of UNIX and its traditional suite of application programs is dramatic Compilation of a small...
- 23
- 1,290
- 1
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... evaluation of Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents ... relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, preclinical data suggest...
- 11
- 655
- 0
Tài liệu Steady State Operation of DC Machines pptx
... of a DC motor Standard data that are given for a DC motor on its nameplate are so-called rated values of output power, armature voltage and current, excitation voltage and current, and speed of ... and equal to rated Mechanical losses and iron core losses can be neglected and armature voltage is constant and equal to rated Calculate rated torque and rated power of the machine whose data ... the two calculated points Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
- 12
- 527
- 1
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... the values of kcat,1 and kcat,2, the maximal GTP activation of uncoupled glutamine hydrolysis was about 14-fold (Table 2) At UTP and ATP concentrations of mM each, a 49-fold increase in kcat was ... data from the activation of CTP synthesis or glutaminase activity by GTP as measured spectrophotometrically was analysed using v ẳ kcat;1 ẵE ỵ kcat;2 ẵE A KA ỵ A 6ị where kcat,1 and kcat,2 are ... in Table 1, and those obtained for the glutaminase reaction in the presence of 0.1 mM each of UTP and ATP-cS (data not shown) Apparently, the value of Ka, kcat,1 and kcat,2 were similar regardless...
- 8
- 698
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... peptide was recorded by sensorgrams allowing an association time of 300 s and a dissociation of 180 s under a constant flow rate of 20 lLÆmin)1 at 25 °C The sensorgram profile of each run was subtracted ... coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation Identification of the active isoform Because of disulfide scrambling ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular...
- 13
- 492
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
The Design and Implementation of a Sequence Database System * docx
... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference on Very Large Databases(VWB), ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query...
- 12
- 568
- 0
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx
... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical...
- 4
- 394
- 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
- 5
- 347
- 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
... CCAACCACTATATTACACCAATGATGGAGCTGAA 700 700 100 Forward Reverse Probe CAACAAAGTGGATATTAAAGACAGGAAAG TGGCAGAAATGTCATAGTACTGAAGATT AAGGCAAAATCTATTGTCTTCCACCGGAAGAA 300 700 200 Forward Reverse Probe CTGGATTTCCTTTGGGCGTT ... Probe AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 300 500 100 Forward Reverse Probe TCTCCTCACTGGAGTTGATGCA AACGGAACCATCCATTTGACA CTCTATGTCGCACCACTGATAACCTGAGACCTT ... Forward Reverse Probe CCGAAGAGGAGTGGAGGAGACT ATATGCGGTTCTGGCTCATGA CATGTAATGAACCCATCCTAGACTCTGTTGGACA 700 700 150 Forward Reverse Probe TGAGGAGGGACAAAACCTTGAA TCGGTCACTGCCAGCATTC CCAACCACTATATTACACCAATGATGGAGCTGAA...
- 13
- 338
- 0
Measuring the Economic Value of a City Park System docx
... by an average of $250 a year McKinley Park, Sacramento PARK VALUE IN ACTION Promoting Human Health in Sacramento Sacramento has 5,141 acres of parks that provide a multitude of ways to stay healthy ... green space in parks First, land cover data are obtained through analysis of aerial photographs This reveals forested as well as open grassy areas and also water surface; it also reveals impervious ... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate...
- 28
- 386
- 0
báo cáo hóa học: " Error mapping controller: a closed loop neuroprosthesis controlled by artificial neural networks" doc
... conception and design, acquisition of data, analysis and interpretation of data and manuscript drafting; EDM have made part of acquisition of data, analysis and interpretation of data and have been ... fixed "a priori" in the model For this reason, the training of the ANNs of EMC was not including any variation of such parameters Anyway, ANNs generalization capability could partly adapt to ... RMSE was obtained when Trec was increased Naturally, the first wave was not affected much by the variation of this parameter, like the variation in Tfat, because fatigue was not yet present at this...
- 13
- 392
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25