... the systems ability to recover the information successfully In fading channels, where the instantaneous SNR is a random variable, the average SNR is used asthe measure Another standard measure ... lu is the channel gain and τlu is the total delay ofthe l th signal path of user u The total delay consists ofthe path delays and the asynchronous access delays between users Therefore the ... analysis was performed fora synchronous TH-UWB and an approximated PDF ofthe interference was used for asynchronous case An approach assuming rectangular mono-pulse shape has been presented...
... The losses of clam stocks were one ofthe biggest problems in the coastal area The reason forthe losses was unknown and this creates a lot of frustration in the area Extensive shrimp cultivation ... Some farmers thought that one of reasons causing losses of clam stocks and clam death was worsen water from upstream Farmers informed that natural clam stocks were disappeared from Ong Mao island ... Erosion has been very strong in the coastal areas, caused mainly by tidal fluctuation, storms, possibly also because ofthe destruction of mangrove forest Many farmers lost their land by erosion...
... One ofthe issues faced by a new sales manager is the fact that the manager is now a team player on themanagement team as well asthe team leader ofthe sales team This dual capacity creates some ... core areas of skills: The communication and interpersonal skills necessary to carry out sales A mastery ofthe sales process and how it relates tothe business Fundamental business competency A solid ... manager and a salesperson By covering some ofthe critical areas of selling, the book will help you develop your staff asa manager as well as fine-tune many ofthe skills you already possess as...
... data adjustment of financial reports ultimately affects the assessment ofa firm by outside stakeholders Several studies have shown that managers have an incentive to manipulate earnings to reach ... provides the basis forthe numerical analysis ofa sequence of numbers ofa similar nature The deviation in actual data from these expected frequencies indicates the presence of manipulation (Thomas, ... Benford 's law and earnings managementThe earnings management issue has become a concern throughout the world (Islam et al., 2011) Earnings management is the managerial use of procedures to adjust...
... and manipulated using XML standards Transformations within activities are expressed with XSLT [12] and XPath [13] The use of XML asthe data format and XML Schema [14] asthe associated ... between tasks, updating the processes as tasks complete or fail, and taking appropriate actions in response The scheduler-based paradigm has been widely used However, there are two alternative paradigms, ... data transfers to visualization servers or archiving of large data sets to mass storage Task scheduling is implemented using Titan, which focuses on the sub-workflow and workflow levels of management...
... Program, 2004-2005 The Appraisal of Development Expenditures Project appraisal and risk managementforthe public sector BASIC NEEDS ANALYSIS SOCIAL ANALYSIS ECONOMIC ANALYSIS FINANCIAL ANALYSIS ... project Should maintain same quality of information across all variables Whenever possible should use secondary information Biased information better than mean values KEY QUESTION a Is this project ... MARKET ANALYSIS TECHNICAL ANALYSIS RESOURCES ANALYSIS ECONOMIC ANALYSIS FINANCIAL ANALYSIS - Cao Hao Thi + - REJECT ? + ? ACCEPT Fulbright Economics Teaching Program, 2004-2005 The Appraisal of...
... problem, many measures would be suggested. The responsibility ofthe scientists is to screen among these alternatives the feasible measures based on applicability and suitability forthe local conditions. ... 2.7. Selection ofthe feasible measures The final stage in the decision making process is to estimate the scores for each ofthe alternatives and choose the most suitable measures forthe objectives and conditions of ... is necessary to have more precise data and a wider range of stakeholders serving forthe assessment task. 5. Conclusions 4. Discussions The application results of MCA method tothe problem of brackish shrimp pond culture ...
... obviously dissatisfied internal and external customers) What can Defense Systems Associates to turn a bad situation around? Themanagementof Defense Systems Associates understands that they have a ... be as complex as performing a quality function deployment analysis, or as simple as listening tothe customer Satisfying the customer has to be a paramount concern, as dissatisfied customers represent ... prepared for Defense Systems Associates to show individual customers within the customer organization (in this case, the U .S Army), and their supplier counterparts in Defense Systems Associates~...
... University, 1998 Raises several strategic management issues for farm business managers A series of exercises that leads a reader through the strategic planning process is also available by contacting ... funds and good capital investment decisions Financial management also addresses the use of tax management strategies; the use of insurance to protect against financial losses that can arise from ... essential to honestly assess your managerial skills and capacities, and toimprove those skills if your assessment indicates that you come up short or are vulnerable The successful farm business of the...
... H) The authors want to emphasis that for n = 1, the result is classical; for n = 2, Theorem 2.6 leads to Theorem 1.1 Shen also shows by providing an example that minimal number of spectral sets ... contributed to each part of this work equally and read and approved the final version ofthe manuscript Competing interests The authors declare that they have no competing interests Received: 28 April ... generalize the above theorem forthe case m ≥ The idea we use is the Weyl s matrix for matrix-valued Sturm-Liouville equation Y + (λIm − Q(x))Y = 0, < x < π (1:5) Some uniqueness theorems for vectorial...
... selected asthe pilot area fortheestablishmentofa sample fire database based on Geographic Information System (GIS) and asthe basis of sample spatial queries in support of fire management Specifically, ... risk assessments offer value Accept uncertainty: uncertainty enters risk assessment as assumptions, estimates and subjective judgments and lack of precise information Even in quantitative assessments ... two ofthe four categories A risk assessment tool will be qualitative or quantitative and formatted as tree or spread sheet This leads toa classification matrix as shown in Table Analysis formatted...
... criteria, consisting ofthe effectiveness, efficiency, appropriateness and sustainability of state management - The Dissertation has evaluated the strengths and weaknesses of state 24 management ... publishing activities 2.2.1 Assessment by criteria of state management 2.2.1.1 Assessment ofthe effectiveness of state management on publishing activities The effectiveness of state management ... From that, the Dissertation has specified the objectives of publishing activities and the assessment criteria of state management on publishing activities - The Dissertation has analyzed the content...
... Iodized seasoned salt is very essential in every Vietnamese family, produced asa result ofthe Vietnam-Australia National program of anti-insufficient disease lodine, can supply a certain amount ... market share in the severely competitive market, a study is conducted based on analysis ofthe company s product strategy and its customer s feedback The study was approved by the head ofthe company s ... this, it is also easy for us to withdraw solutions forthe company Next, based on the preceded analysis, recommendations are given with some helpful solutions forthe Hai Chau company Finally,...
... lactis ald gene as follows A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) ... was used for integration of synthetic promoters upstream tothe las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as ... work was supported by the Danish Dairy Research Foundation (Danish Dairy Board), the Danish Research Agency and the Danish Center for Advance Food Studies (LMC) 2301 Control analysis ofthe las operon...
... degrees, teachers with specialized training in early education, assistants with Child Development Associate (CDA) credentials, teachers and assistants receiving at least 15 hours of in-service training ... Washington have proposed funding increases despite budget deficits In addition, policymakers in Nebraska, North Carolina, Arkansas, and Massachusetts have expanded access, improved quality, increased ... analyses, estimates of fiscal benefits that only include the savings and revenues that affect states and exclude the benefits to individuals (such as increased earnings) continue to demonstrate...
... Johanna Jửnsson 0.214 was used asa base case; and forthe case when the mill was modelled within the same system boundary asa utility, Papers I-III, a capital recovery factor of 0.1 was used as ... is assumed that the excess heat exported from the studied system will be used as part ofthe base load in a district heating system and thus affect the building of base load capacity The district ... assessing a mills steam balance, assuming only a limited amount of data, is developed and applied toa case study It is investigated which energy-related data are publicly and/or easily accessible...
... in the Couvent des Anglaises at about the same time as Maurice de Saxe 's granddaughter It was in this way that the fusion of classes was understood under the Terror She was employed asa figurante ... us of Madame Marie-Xavier, and of her despair at having taken the vows; of Sister Anne-Joseph, who was as kind as an angel and as silly asa goose; ofthe gentle Marie-Alicia, whose serene soul ... over The boundless hopes and the enthusiasm of 1831 were things ofthe past "The Republic, as it was dreamed of in July," she writes, "has ended in the massacres of Warsaw and in the holocaust of...
... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed asmean ± SD Student s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was used to ... denaturation assay, using lysates of K562 cells (data not shown) Discussion Whereas the importance of HSPs in the pathogenesis of many diseases is well established together with their potential...